ID: 1003935712

View in Genome Browser
Species Human (GRCh38)
Location 6:10973230-10973252
Sequence GAGCATCTAATTGGGCTGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003935707_1003935712 -3 Left 1003935707 6:10973210-10973232 CCTACCAACCTCTTATTTATGAG 0: 1
1: 0
2: 0
3: 10
4: 162
Right 1003935712 6:10973230-10973252 GAGCATCTAATTGGGCTGATAGG No data
1003935705_1003935712 16 Left 1003935705 6:10973191-10973213 CCCTCAGTTGATATCAGCTCCTA 0: 1
1: 0
2: 1
3: 13
4: 125
Right 1003935712 6:10973230-10973252 GAGCATCTAATTGGGCTGATAGG No data
1003935706_1003935712 15 Left 1003935706 6:10973192-10973214 CCTCAGTTGATATCAGCTCCTAC 0: 1
1: 0
2: 1
3: 5
4: 110
Right 1003935712 6:10973230-10973252 GAGCATCTAATTGGGCTGATAGG No data
1003935708_1003935712 -7 Left 1003935708 6:10973214-10973236 CCAACCTCTTATTTATGAGCATC 0: 1
1: 0
2: 0
3: 14
4: 212
Right 1003935712 6:10973230-10973252 GAGCATCTAATTGGGCTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003935712 Original CRISPR GAGCATCTAATTGGGCTGAT AGG Intronic
No off target data available for this crispr