ID: 1003936150

View in Genome Browser
Species Human (GRCh38)
Location 6:10977024-10977046
Sequence CTTTCAGGGGGATTTGCTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1344
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 1300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003936141_1003936150 20 Left 1003936141 6:10976981-10977003 CCGAGGCCAGTTTTTTTGCAGGG 0: 1
1: 0
2: 1
3: 17
4: 166
Right 1003936150 6:10977024-10977046 CTTTCAGGGGGATTTGCTAGAGG 0: 1
1: 0
2: 0
3: 43
4: 1300
1003936143_1003936150 14 Left 1003936143 6:10976987-10977009 CCAGTTTTTTTGCAGGGTTCAGG 0: 1
1: 0
2: 4
3: 44
4: 401
Right 1003936150 6:10977024-10977046 CTTTCAGGGGGATTTGCTAGAGG 0: 1
1: 0
2: 0
3: 43
4: 1300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003936150 Original CRISPR CTTTCAGGGGGATTTGCTAG AGG Intronic
900216051 1:1482244-1482266 CCTTCAGGCGGATCTGCTCGCGG - Exonic
900223171 1:1520247-1520269 CCTTCAGGCGGATCTGCTCGCGG - Exonic
904700929 1:32357702-32357724 ATTTGTGGGGGATTTGCTTGTGG + Intronic
904967973 1:34394245-34394267 CTTGCATGGGGCTTTGCTGGTGG + Intergenic
904977883 1:34472524-34472546 CTTTCACTGGGATAGGCTAGAGG - Intergenic
907929975 1:58990358-58990380 CTTTCAGGAGGCCATGCTAGGGG - Intergenic
913744590 1:121888177-121888199 CTTTCAGTGGAATCTGCAAGCGG - Intergenic
913745425 1:121898203-121898225 CTTTCGGGGGAATCTGCAAGCGG - Intergenic
913767955 1:122214094-122214116 CTTTCAGTGGAATCTGCAAGCGG + Intergenic
913772313 1:122270945-122270967 CTTTCAGTGGAATCTGCAAGCGG + Intergenic
913788095 1:122481828-122481850 CTTTCAGTGGAATCTGCAAGCGG + Intergenic
913790233 1:122512683-122512705 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913790579 1:122518807-122518829 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913791892 1:122542609-122542631 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
913792232 1:122549067-122549089 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
913793660 1:122574572-122574594 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
913800296 1:122693233-122693255 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913800782 1:122701728-122701750 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913812394 1:122910813-122910835 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
913813143 1:122924418-122924440 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
913815354 1:122964193-122964215 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913824479 1:123127492-123127514 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913824536 1:123128511-123128533 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913826938 1:123171016-123171038 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913827421 1:123179514-123179536 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
913831559 1:123254594-123254616 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
913834614 1:123308635-123308657 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913834966 1:123315102-123315124 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913836444 1:123341273-123341295 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913850346 1:123591229-123591251 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
913850635 1:123596332-123596354 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
913858159 1:123731786-123731808 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
913864552 1:123845990-123846012 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913871841 1:123977001-123977023 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913873946 1:124015067-124015089 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913874173 1:124019145-124019167 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
913883028 1:124177437-124177459 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
913883252 1:124181517-124181539 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
913885734 1:124225365-124225387 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
913888516 1:124275148-124275170 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913891678 1:124332267-124332289 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
913896183 1:124412670-124412692 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913897276 1:124432381-124432403 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913902679 1:124529239-124529261 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913904306 1:124558458-124558480 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
913904867 1:124568660-124568682 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
913909612 1:124653643-124653665 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
913912398 1:124703613-124703635 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
913914000 1:124732163-124732185 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
913917123 1:124787318-124787340 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913917259 1:124788848-124788870 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913917516 1:124791911-124791933 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913917649 1:124793441-124793463 CTTTCAGTGGGATCTGCAAGTGG + Intergenic
913917775 1:124794971-124794993 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913917904 1:124796503-124796525 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913918035 1:124798033-124798055 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913918165 1:124799563-124799585 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913918298 1:124801093-124801115 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913918561 1:124804152-124804174 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913918692 1:124805682-124805704 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913918821 1:124807212-124807234 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913918954 1:124808741-124808763 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913919087 1:124810272-124810294 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913919222 1:124811802-124811824 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913919354 1:124813332-124813354 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913919485 1:124814862-124814884 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913919619 1:124816392-124816414 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913919751 1:124817924-124817946 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913919880 1:124819454-124819476 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913920010 1:124820984-124821006 CTTTGAGTGGGATCTGCAAGCGG + Intergenic
913920139 1:124822514-124822536 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913920270 1:124824045-124824067 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913920407 1:124825577-124825599 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913920539 1:124827108-124827130 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913920679 1:124828638-124828660 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913920816 1:124830168-124830190 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913920946 1:124831698-124831720 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913921078 1:124833228-124833250 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913921210 1:124834758-124834780 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913921336 1:124836289-124836311 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913921470 1:124837818-124837840 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913921735 1:124840882-124840904 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913921868 1:124842412-124842434 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913921999 1:124843942-124843964 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913922129 1:124845472-124845494 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913922261 1:124847002-124847024 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913922533 1:124850335-124850357 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913922775 1:124853394-124853416 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913923016 1:124856450-124856472 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913923386 1:124861040-124861062 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913923509 1:124862571-124862593 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913923624 1:124864099-124864121 CTTTCAGTGTGATCTGCAAGCGG + Intergenic
913923748 1:124865629-124865651 CTTTCAGTGGGACCTGCAAGCGG + Intergenic
913923872 1:124867159-124867181 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913923988 1:124868687-124868709 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913924107 1:124870217-124870239 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913924233 1:124871748-124871770 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913924355 1:124873281-124873303 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913924481 1:124874809-124874831 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913924601 1:124876338-124876360 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913924725 1:124877868-124877890 CTTTGAGTGGGATCTGCAAGCGG + Intergenic
913924850 1:124879401-124879423 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913925091 1:124882461-124882483 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913925213 1:124883990-124884012 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913925457 1:124887056-124887078 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913925702 1:124890119-124890141 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913925825 1:124891650-124891672 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913926072 1:124894710-124894732 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913926197 1:124896240-124896262 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913926449 1:124899301-124899323 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913926568 1:124900830-124900852 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913926693 1:124902364-124902386 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913926809 1:124903893-124903915 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913927288 1:124910017-124910039 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913927411 1:124911550-124911572 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913927534 1:124913082-124913104 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913927659 1:124914611-124914633 CTTTCAGTGGGATCTGCAAGTGG + Intergenic
913927907 1:124917668-124917690 CTTTCAGTGGGAACTGCAAGCGG + Intergenic
913928024 1:124919201-124919223 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913928144 1:124920731-124920753 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913928269 1:124922260-124922282 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913928389 1:124923790-124923812 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913928511 1:124925326-124925348 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913928629 1:124926856-124926878 CTTTCAGTGGGATCTGCAAGCGG + Intergenic
913928752 1:124928389-124928411 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
913928873 1:124929922-124929944 CTTTCAGAGGGAACTGCAAGCGG + Intergenic
913929157 1:124933440-124933462 CTTTCAGTGGGAACTGCAAGCGG - Intergenic
913929517 1:124938030-124938052 CTTTCAGTGGGATCTGCAAGCGG - Intergenic
913929748 1:124941089-124941111 CTTTCAGTGGGATCTGCAAGCGG - Intergenic
916487535 1:165272737-165272759 CAGTCAGGGTGGTTTGCTAGGGG + Intronic
919979129 1:202631493-202631515 CTCTCAGGGGACTTTGCTTGGGG - Intronic
922122537 1:222686845-222686867 CTTTCTTTGGTATTTGCTAGTGG - Intronic
1063497716 10:6525767-6525789 CTTTGAGGGGGATCTGCTGGAGG + Intronic
1063908358 10:10803581-10803603 CCATCAGGGAGATGTGCTAGAGG - Intergenic
1066058284 10:31701112-31701134 CTTACAGGGGGTTTTGTTTGTGG + Intergenic
1066825814 10:39574323-39574345 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066825957 10:39577036-39577058 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826088 10:39579749-39579771 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826245 10:39582459-39582481 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826299 10:39583478-39583500 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826365 10:39584834-39584856 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826402 10:39590612-39590634 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826472 10:39591969-39591991 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826559 10:39598067-39598089 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826694 10:39600725-39600747 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066826757 10:39602081-39602103 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827228 10:39610855-39610877 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827390 10:39616466-39616488 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827476 10:39618113-39618135 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827548 10:39619470-39619492 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827618 10:39620828-39620850 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827696 10:39625362-39625384 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827761 10:39626718-39626740 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827778 10:39627058-39627080 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827845 10:39628414-39628436 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827864 10:39628750-39628772 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827928 10:39630107-39630129 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066827945 10:39630447-39630469 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066828031 10:39632128-39632150 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066828094 10:39633485-39633507 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066828159 10:39634843-39634865 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066828238 10:39636483-39636505 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842326 10:39941345-39941367 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842396 10:39942702-39942724 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842460 10:39944061-39944083 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842527 10:39945419-39945441 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842562 10:39946099-39946121 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842633 10:39947458-39947480 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842701 10:39948814-39948836 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842838 10:39951530-39951552 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066842905 10:39952884-39952906 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066843045 10:39955599-39955621 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066843248 10:39959675-39959697 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066843391 10:39962390-39962412 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066843461 10:39963748-39963770 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066843594 10:39966463-39966485 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066843903 10:39972568-39972590 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066843972 10:39973926-39973948 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066844043 10:39975285-39975307 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066844112 10:39976643-39976665 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066844185 10:39978005-39978027 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066844319 10:39980722-39980744 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066844370 10:39981744-39981766 CTTTCAGTGGAATTTGCAAGTGG + Intergenic
1066844559 10:39985482-39985504 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066844682 10:39987860-39987882 CTTTCTGTGGGGTTTGCAAGTGG + Intergenic
1066844751 10:39989219-39989241 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845049 10:39994989-39995011 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845116 10:39996347-39996369 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845268 10:39999403-39999425 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845333 10:40000761-40000783 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845470 10:40003476-40003498 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845705 10:40007889-40007911 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845769 10:40009247-40009269 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845902 10:40011949-40011971 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066845975 10:40013307-40013329 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846064 10:40015004-40015026 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846133 10:40016362-40016384 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846203 10:40017720-40017742 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846237 10:40018401-40018423 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846428 10:40022134-40022156 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846497 10:40023492-40023514 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846623 10:40025869-40025891 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846692 10:40027228-40027250 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846760 10:40028586-40028608 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846826 10:40029944-40029966 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846899 10:40031302-40031324 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066846967 10:40032660-40032682 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847032 10:40034018-40034040 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847101 10:40035376-40035398 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847174 10:40036734-40036756 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847243 10:40038092-40038114 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847310 10:40039451-40039473 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847379 10:40040809-40040831 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847449 10:40042167-40042189 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847517 10:40043524-40043546 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847590 10:40044880-40044902 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847658 10:40046238-40046260 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847724 10:40047598-40047620 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847792 10:40048955-40048977 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847863 10:40050313-40050335 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847932 10:40051671-40051693 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066847997 10:40053028-40053050 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848064 10:40054387-40054409 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848129 10:40055745-40055767 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848195 10:40057103-40057125 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848262 10:40058461-40058483 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848299 10:40059141-40059163 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848336 10:40059821-40059843 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848403 10:40061179-40061201 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848474 10:40062536-40062558 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066848538 10:40063894-40063916 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066849051 10:40074080-40074102 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066849105 10:40075100-40075122 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066849789 10:40088676-40088698 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066849855 10:40090034-40090056 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066849922 10:40091392-40091414 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850060 10:40094107-40094129 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850126 10:40095466-40095488 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850197 10:40096826-40096848 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850470 10:40102258-40102280 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850537 10:40103617-40103639 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850654 10:40105996-40106018 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850722 10:40107353-40107375 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850775 10:40108372-40108394 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850828 10:40109391-40109413 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850896 10:40110749-40110771 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066850917 10:40111085-40111107 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
1066850966 10:40112103-40112125 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851001 10:40112783-40112805 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851069 10:40114140-40114162 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851136 10:40115499-40115521 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851202 10:40116857-40116879 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851268 10:40118214-40118236 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851335 10:40119572-40119594 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851402 10:40120930-40120952 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851473 10:40122288-40122310 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851576 10:40124324-40124346 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851645 10:40125682-40125704 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851711 10:40127040-40127062 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066851952 10:40131800-40131822 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852090 10:40134511-40134533 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852329 10:40139265-40139287 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852395 10:40140623-40140645 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852514 10:40143002-40143024 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852579 10:40144360-40144382 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852647 10:40145718-40145740 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852715 10:40147078-40147100 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852892 10:40150470-40150492 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066852960 10:40151830-40151852 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853028 10:40153188-40153210 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853099 10:40154546-40154568 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853169 10:40155904-40155926 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853234 10:40157263-40157285 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853406 10:40160660-40160682 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853477 10:40162018-40162040 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853545 10:40163377-40163399 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853579 10:40164057-40164079 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853646 10:40165415-40165437 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853696 10:40166436-40166458 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853763 10:40167794-40167816 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853829 10:40169153-40169175 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853885 10:40170174-40170196 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066853957 10:40171533-40171555 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854023 10:40172895-40172917 CTTTCAGTGGAATTTGCAAGTGG + Intergenic
1066854090 10:40174254-40174276 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854159 10:40175612-40175634 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854226 10:40176970-40176992 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854294 10:40178327-40178349 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854360 10:40179685-40179707 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854394 10:40180365-40180387 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854446 10:40181385-40181407 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854515 10:40182741-40182763 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854585 10:40184099-40184121 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854801 10:40188173-40188195 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854872 10:40189531-40189553 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066854942 10:40190889-40190911 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855092 10:40193949-40193971 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855148 10:40194967-40194989 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855216 10:40196325-40196347 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855286 10:40197683-40197705 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855354 10:40199040-40199062 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855425 10:40200398-40200420 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855598 10:40203795-40203817 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855853 10:40208894-40208916 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855918 10:40210252-40210274 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066855989 10:40211610-40211632 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856057 10:40212968-40212990 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856124 10:40214326-40214348 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856193 10:40215684-40215706 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856634 10:40224517-40224539 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856703 10:40225875-40225897 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856773 10:40227233-40227255 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856890 10:40229610-40229632 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066856960 10:40230968-40230990 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857011 10:40231986-40232008 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857079 10:40233344-40233366 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857132 10:40234363-40234385 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857200 10:40235721-40235743 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857266 10:40237079-40237101 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857301 10:40237759-40237781 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857368 10:40239117-40239139 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857437 10:40240475-40240497 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857471 10:40241155-40241177 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857537 10:40242512-40242534 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857574 10:40243192-40243214 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857608 10:40243872-40243894 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857675 10:40245230-40245252 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857843 10:40248626-40248648 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857910 10:40249982-40250004 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066857979 10:40251340-40251362 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858046 10:40252699-40252721 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858118 10:40254058-40254080 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858188 10:40255416-40255438 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858240 10:40256435-40256457 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858274 10:40257115-40257137 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858413 10:40259834-40259856 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858483 10:40261191-40261213 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858668 10:40264926-40264948 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858842 10:40268321-40268343 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858944 10:40270358-40270380 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066858981 10:40271038-40271060 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859047 10:40272396-40272418 CTTTCAGTGGAATTTGCAAGTGG + Intergenic
1066859114 10:40273756-40273778 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859180 10:40275114-40275136 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859248 10:40276472-40276494 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859353 10:40278507-40278529 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859475 10:40280883-40280905 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859541 10:40282241-40282263 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859610 10:40283598-40283620 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066859973 10:40290728-40290750 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860039 10:40292088-40292110 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860107 10:40293446-40293468 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860176 10:40294804-40294826 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860246 10:40296162-40296184 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860313 10:40297520-40297542 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860380 10:40298876-40298898 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860467 10:40300572-40300594 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860537 10:40301932-40301954 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860604 10:40303290-40303312 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860671 10:40304648-40304670 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860740 10:40306006-40306028 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860812 10:40307364-40307386 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860880 10:40308723-40308745 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066860947 10:40310080-40310102 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861016 10:40311438-40311460 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861082 10:40312796-40312818 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861148 10:40314154-40314176 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861271 10:40316531-40316553 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861336 10:40317890-40317912 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861405 10:40319246-40319268 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861474 10:40320604-40320626 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861542 10:40321958-40321980 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861608 10:40323316-40323338 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861677 10:40324674-40324696 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861797 10:40327053-40327075 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066861868 10:40328410-40328432 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066861934 10:40329768-40329790 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862000 10:40331126-40331148 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862015 10:40331466-40331488 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862215 10:40335541-40335563 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862420 10:40339615-40339637 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862513 10:40341310-40341332 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862550 10:40341990-40342012 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862586 10:40342670-40342692 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862640 10:40343689-40343711 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862873 10:40348443-40348465 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066862939 10:40349801-40349823 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863008 10:40351159-40351181 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863043 10:40351839-40351861 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863130 10:40353535-40353557 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863198 10:40354893-40354915 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863267 10:40356250-40356272 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863334 10:40357609-40357631 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863403 10:40358967-40358989 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863469 10:40360325-40360347 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863539 10:40361684-40361706 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863586 10:40362701-40362723 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863654 10:40364059-40364081 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863752 10:40366093-40366115 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066863953 10:40370163-40370185 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066864414 10:40379329-40379351 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066864549 10:40382045-40382067 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066864619 10:40383403-40383425 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066864689 10:40384761-40384783 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066864719 10:40385443-40385465 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066864789 10:40386801-40386823 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865040 10:40391903-40391925 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865255 10:40396318-40396340 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865514 10:40401413-40401435 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865582 10:40402771-40402793 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865651 10:40404129-40404151 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865700 10:40405147-40405169 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865766 10:40406505-40406527 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066865799 10:40407181-40407203 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866189 10:40414992-40415014 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866259 10:40416349-40416371 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866323 10:40417707-40417729 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866376 10:40418727-40418749 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866445 10:40420085-40420107 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866583 10:40422803-40422825 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866654 10:40424160-40424182 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066866724 10:40425518-40425540 CTTTCAGTGGAATTTGCAAGTGG + Intergenic
1066866811 10:40427216-40427238 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867001 10:40430952-40430974 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867071 10:40432310-40432332 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867138 10:40433668-40433690 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867207 10:40435026-40435048 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867334 10:40437406-40437428 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867385 10:40438420-40438442 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867453 10:40439778-40439800 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867664 10:40443850-40443872 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867748 10:40445547-40445569 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
1066867794 10:40446565-40446587 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867813 10:40446906-40446928 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867863 10:40447923-40447945 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867911 10:40448943-40448965 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066867980 10:40450301-40450323 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868049 10:40451659-40451681 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868118 10:40453017-40453039 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868332 10:40457438-40457460 CTTTCAGTGGAATTTGCAAGTGG + Intergenic
1066868381 10:40458457-40458479 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868450 10:40459817-40459839 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868642 10:40463549-40463571 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868708 10:40464907-40464929 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868920 10:40468979-40469001 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066868972 10:40470001-40470023 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869042 10:40471359-40471381 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869132 10:40473055-40473077 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869185 10:40474075-40474097 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869221 10:40474755-40474777 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869289 10:40476114-40476136 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869518 10:40480870-40480892 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869571 10:40481891-40481913 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869862 10:40487662-40487684 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066869972 10:40489697-40489719 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870088 10:40492072-40492094 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870140 10:40493091-40493113 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870216 10:40494540-40494562 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870408 10:40498271-40498293 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870480 10:40499630-40499652 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870547 10:40500988-40501010 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870666 10:40503365-40503387 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066870788 10:40505740-40505762 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871081 10:40511509-40511531 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871147 10:40512868-40512890 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871318 10:40516269-40516291 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871615 10:40522044-40522066 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871700 10:40523740-40523762 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871800 10:40525777-40525799 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871883 10:40527473-40527495 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066871952 10:40528831-40528853 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066872018 10:40530189-40530211 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066872070 10:40531207-40531229 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066872187 10:40533583-40533605 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066872260 10:40534942-40534964 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066872347 10:40536638-40536660 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066872465 10:40539015-40539037 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873009 10:40549876-40549898 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873080 10:40551231-40551253 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873147 10:40552590-40552612 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873216 10:40553949-40553971 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873461 10:40559043-40559065 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873530 10:40560401-40560423 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873599 10:40561759-40561781 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873650 10:40562778-40562800 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873717 10:40564136-40564158 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873784 10:40565494-40565516 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873853 10:40566852-40566874 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066873943 10:40568548-40568570 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874013 10:40569908-40569930 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874081 10:40571266-40571288 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874146 10:40572625-40572647 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874215 10:40573983-40574005 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874334 10:40576359-40576381 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874403 10:40577717-40577739 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874506 10:40579757-40579779 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874561 10:40580775-40580797 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874614 10:40581793-40581815 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874748 10:40584150-40584172 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066874816 10:40585508-40585530 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066875330 10:40595692-40595714 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066875685 10:40602824-40602846 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066875832 10:40605878-40605900 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066875988 10:40608931-40608953 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876037 10:40609952-40609974 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876091 10:40610971-40610993 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876222 10:40613687-40613709 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876359 10:40616403-40616425 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876377 10:40616742-40616764 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
1066876619 10:40621492-40621514 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876669 10:40622510-40622532 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876703 10:40623190-40623212 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876772 10:40624548-40624570 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876838 10:40625906-40625928 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876921 10:40627604-40627626 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066876988 10:40628962-40628984 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877054 10:40630320-40630342 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877088 10:40631000-40631022 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877158 10:40632358-40632380 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877292 10:40635073-40635095 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877358 10:40636431-40636453 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877425 10:40637790-40637812 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877476 10:40638808-40638830 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877575 10:40640845-40640867 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877641 10:40642203-40642225 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877689 10:40643224-40643246 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877841 10:40646281-40646303 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877943 10:40648321-40648343 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066877996 10:40649339-40649361 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878047 10:40650358-40650380 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878084 10:40651038-40651060 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878121 10:40651717-40651739 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878245 10:40654094-40654116 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878313 10:40655450-40655472 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878367 10:40656468-40656490 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878419 10:40657486-40657508 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066878734 10:40663937-40663959 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879141 10:40672090-40672112 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879192 10:40673109-40673131 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879260 10:40674467-40674489 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879309 10:40675485-40675507 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879519 10:40679559-40679581 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879778 10:40684648-40684670 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879879 10:40686685-40686707 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066879914 10:40687365-40687387 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880032 10:40689743-40689765 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880101 10:40691101-40691123 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880119 10:40691440-40691462 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
1066880149 10:40692118-40692140 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880205 10:40693138-40693160 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880239 10:40693818-40693840 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880292 10:40694824-40694846 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880360 10:40696182-40696204 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880427 10:40697540-40697562 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880492 10:40698898-40698920 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880529 10:40699578-40699600 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880629 10:40701614-40701636 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880680 10:40702632-40702654 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880752 10:40703990-40704012 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880956 10:40708065-40708087 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066880991 10:40708745-40708767 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881040 10:40709765-40709787 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881092 10:40710782-40710804 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881144 10:40711800-40711822 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881178 10:40712479-40712501 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881233 10:40713500-40713522 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881431 10:40717573-40717595 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881483 10:40718593-40718615 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881518 10:40719273-40719295 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881587 10:40720631-40720653 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881641 10:40721651-40721673 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066881693 10:40722669-40722691 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066881867 10:40724730-40724752 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066881936 10:40726089-40726111 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882039 10:40728125-40728147 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882193 10:40731183-40731205 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882262 10:40732541-40732563 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882431 10:40735937-40735959 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882567 10:40738653-40738675 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882707 10:40741369-40741391 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882780 10:40742727-40742749 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882847 10:40744085-40744107 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066882967 10:40746461-40746483 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883036 10:40747816-40747838 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883071 10:40748496-40748518 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883127 10:40749514-40749536 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883360 10:40754265-40754287 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883413 10:40755283-40755305 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883591 10:40759015-40759037 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883816 10:40763431-40763453 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883869 10:40764448-40764470 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883916 10:40765468-40765490 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066883985 10:40766829-40766851 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884038 10:40767847-40767869 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884137 10:40769886-40769908 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884289 10:40772942-40772964 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884391 10:40774979-40775001 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884442 10:40775998-40776020 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884495 10:40777019-40777041 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884563 10:40778377-40778399 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884618 10:40779397-40779419 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884686 10:40780756-40780778 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884752 10:40782115-40782137 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884802 10:40783134-40783156 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884852 10:40784155-40784177 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066884924 10:40785514-40785536 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066885011 10:40787212-40787234 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
1066885041 10:40787892-40787914 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066885092 10:40788910-40788932 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066885126 10:40789590-40789612 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066885234 10:40791626-40791648 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066885358 10:40794003-40794025 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066885392 10:40794683-40794705 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066885490 10:40796720-40796742 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886077 10:40807927-40807949 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886130 10:40808947-40808969 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886180 10:40809967-40809989 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886351 10:40813362-40813384 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886402 10:40814380-40814402 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886472 10:40815735-40815757 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886631 10:40818789-40818811 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886696 10:40820151-40820173 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886747 10:40821169-40821191 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886868 10:40823548-40823570 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886948 10:40825247-40825269 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066886997 10:40826264-40826286 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066887167 10:40829656-40829678 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066887233 10:40831015-40831037 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066887284 10:40832035-40832057 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066887728 10:40840863-40840885 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066887834 10:40842901-40842923 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066887885 10:40843919-40843941 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888039 10:40846976-40846998 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888196 10:40850027-40850049 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888294 10:40852065-40852087 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888366 10:40853424-40853446 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888403 10:40854104-40854126 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888450 10:40855120-40855142 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888495 10:40856139-40856161 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888597 10:40858161-40858183 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888648 10:40859179-40859201 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888748 10:40861217-40861239 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888920 10:40864610-40864632 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066888973 10:40865628-40865650 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889020 10:40866648-40866670 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889072 10:40867668-40867690 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889198 10:40870044-40870066 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889269 10:40871401-40871423 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889319 10:40872422-40872444 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889402 10:40874122-40874144 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889451 10:40875142-40875164 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889507 10:40876159-40876181 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889576 10:40877517-40877539 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889775 10:40881251-40881273 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889845 10:40882607-40882629 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066889950 10:40884642-40884664 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890000 10:40885662-40885684 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890051 10:40886680-40886702 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890102 10:40887698-40887720 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890157 10:40888718-40888740 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890255 10:40890756-40890778 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890357 10:40892797-40892819 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890720 10:40899583-40899605 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890806 10:40901282-40901304 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890840 10:40901962-40901984 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066890891 10:40902982-40903004 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891198 10:40909087-40909109 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891248 10:40910107-40910129 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891297 10:40911125-40911147 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891415 10:40913504-40913526 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891535 10:40915879-40915901 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891586 10:40916896-40916918 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891637 10:40917915-40917937 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891690 10:40918934-40918956 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891837 10:40921988-40922010 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066891904 10:40923346-40923368 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892007 10:40925387-40925409 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892060 10:40926407-40926429 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892111 10:40927426-40927448 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892238 10:40929619-40929641 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892289 10:40930637-40930659 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892416 10:40933014-40933036 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892529 10:40935391-40935413 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892575 10:40936411-40936433 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066892783 10:40940481-40940503 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066893068 10:40946247-40946269 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066893398 10:40952695-40952717 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066893452 10:40953713-40953735 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066893505 10:40954733-40954755 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066893691 10:40958473-40958495 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894064 10:40965947-40965969 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894182 10:40968325-40968347 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894234 10:40969344-40969366 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894287 10:40970362-40970384 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894338 10:40971381-40971403 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894385 10:40972400-40972422 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894638 10:40977495-40977517 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894741 10:40979534-40979556 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894761 10:40979873-40979895 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
1066894794 10:40980551-40980573 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066894898 10:40982591-40982613 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895007 10:40984628-40984650 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895051 10:40985647-40985669 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895101 10:40986667-40986689 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895247 10:40989722-40989744 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895297 10:40990742-40990764 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895397 10:40992783-40992805 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895447 10:40993801-40993823 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895499 10:40994822-40994844 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895554 10:40995841-40995863 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895658 10:40997882-40997904 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066895827 10:41001277-41001299 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
1066896059 10:41005687-41005709 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896128 10:41007047-41007069 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896181 10:41008062-41008084 CTTTCAGTGGAATTTGCAAGTGG + Intergenic
1066896234 10:41009079-41009101 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896288 10:41010099-41010121 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896322 10:41010775-41010797 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896375 10:41011793-41011815 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896428 10:41012813-41012835 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896535 10:41014852-41014874 CTTTCTGTGGAATTTGCAAGGGG + Intergenic
1066896759 10:41019271-41019293 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896809 10:41020290-41020312 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896864 10:41021308-41021330 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066896916 10:41022328-41022350 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897257 10:41029114-41029136 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897376 10:41031493-41031515 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897421 10:41032512-41032534 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897471 10:41033532-41033554 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897625 10:41036588-41036610 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897679 10:41037607-41037629 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897836 10:41040665-41040687 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897938 10:41042702-41042724 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066897991 10:41043719-41043741 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066898079 10:41045419-41045441 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066898418 10:41052208-41052230 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066898564 10:41054923-41054945 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066898615 10:41055942-41055964 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066898737 10:41058315-41058337 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066898792 10:41059334-41059356 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066898842 10:41060352-41060374 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899034 10:41064090-41064112 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899085 10:41065108-41065130 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899150 10:41066466-41066488 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899205 10:41067485-41067507 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899355 10:41070539-41070561 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899387 10:41071219-41071241 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899407 10:41071559-41071581 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899616 10:41075977-41075999 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899818 10:41080054-41080076 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066899919 10:41082092-41082114 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900096 10:41085489-41085511 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900148 10:41086507-41086529 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900364 10:41090918-41090940 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900432 10:41092274-41092296 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900489 10:41093293-41093315 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900541 10:41094312-41094334 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900590 10:41095332-41095354 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900641 10:41096350-41096372 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900747 10:41098387-41098409 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900818 10:41099745-41099767 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900870 10:41100763-41100785 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900925 10:41101780-41101802 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066900978 10:41102798-41102820 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901032 10:41103816-41103838 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901190 10:41106871-41106893 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901261 10:41108229-41108251 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901312 10:41109249-41109271 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901427 10:41111629-41111651 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901600 10:41115027-41115049 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901657 10:41116043-41116065 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901711 10:41117061-41117083 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066901779 10:41118419-41118441 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902038 10:41123514-41123536 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902089 10:41124533-41124555 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902244 10:41127592-41127614 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902331 10:41129290-41129312 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902519 10:41133030-41133052 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902605 10:41134725-41134747 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902656 10:41135745-41135767 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902707 10:41136762-41136784 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902861 10:41139822-41139844 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066902914 10:41140842-41140864 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903020 10:41142880-41142902 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903122 10:41144918-41144940 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903173 10:41145935-41145957 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903227 10:41146955-41146977 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903283 10:41147976-41147998 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903336 10:41148996-41149018 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903390 10:41150015-41150037 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903441 10:41151035-41151057 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903514 10:41152393-41152415 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903566 10:41153412-41153434 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903621 10:41154432-41154454 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903674 10:41155452-41155474 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903778 10:41157487-41157509 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066903849 10:41158845-41158867 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066903897 10:41159865-41159887 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904002 10:41161901-41161923 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904072 10:41163259-41163281 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904125 10:41164280-41164302 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904173 10:41165299-41165321 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904231 10:41166318-41166340 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904352 10:41168697-41168719 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904406 10:41169716-41169738 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904460 10:41170733-41170755 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904518 10:41171750-41171772 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066904563 10:41172770-41172792 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904668 10:41174808-41174830 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904732 10:41176166-41176188 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904907 10:41179564-41179586 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066904959 10:41180583-41180605 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905010 10:41181601-41181623 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905062 10:41182618-41182640 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905164 10:41184658-41184680 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905382 10:41189072-41189094 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905484 10:41191110-41191132 CTTTCAGTGGAATTTGCAAGTGG + Intergenic
1066905538 10:41192128-41192150 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905596 10:41193146-41193168 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905650 10:41194164-41194186 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905700 10:41195181-41195203 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905752 10:41196202-41196224 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905805 10:41197222-41197244 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905860 10:41198240-41198262 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905930 10:41199598-41199620 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066905985 10:41200614-41200636 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906088 10:41202653-41202675 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906139 10:41203674-41203696 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906395 10:41208769-41208791 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906448 10:41209787-41209809 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906519 10:41211144-41211166 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906573 10:41212160-41212182 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906622 10:41213178-41213200 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906676 10:41214196-41214218 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906723 10:41215216-41215238 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906773 10:41216236-41216258 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906822 10:41217254-41217276 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906870 10:41218273-41218295 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906922 10:41219296-41219318 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066906975 10:41220314-41220336 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907024 10:41221334-41221356 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907095 10:41222692-41222714 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907146 10:41223712-41223734 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907249 10:41225751-41225773 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907304 10:41226770-41226792 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907355 10:41227788-41227810 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907402 10:41228807-41228829 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907506 10:41230845-41230867 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907559 10:41231865-41231887 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907646 10:41233562-41233584 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907697 10:41234582-41234604 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907753 10:41235600-41235622 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907809 10:41236615-41236637 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907908 10:41238656-41238678 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066907960 10:41239677-41239699 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908014 10:41240695-41240717 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908122 10:41242738-41242760 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908173 10:41243758-41243780 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908224 10:41244776-41244798 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908274 10:41245795-41245817 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908326 10:41246815-41246837 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908377 10:41247836-41247858 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908634 10:41252930-41252952 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908789 10:41255989-41256011 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908843 10:41257010-41257032 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908894 10:41258029-41258051 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066908945 10:41259048-41259070 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909104 10:41262104-41262126 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909320 10:41266179-41266201 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909470 10:41269236-41269258 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909678 10:41273314-41273336 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909731 10:41274334-41274356 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909829 10:41276370-41276392 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909897 10:41277730-41277752 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066909951 10:41278749-41278771 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910058 10:41280788-41280810 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910183 10:41283166-41283188 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910236 10:41284185-41284207 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910289 10:41285205-41285227 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910340 10:41286223-41286245 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910442 10:41288263-41288285 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910564 10:41290641-41290663 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910615 10:41291660-41291682 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910668 10:41292678-41292700 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910720 10:41293697-41293719 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066910776 10:41294717-41294739 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910822 10:41295735-41295757 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910894 10:41297090-41297112 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910946 10:41298110-41298132 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066910998 10:41299130-41299152 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911053 10:41300148-41300170 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911124 10:41301503-41301525 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911233 10:41303543-41303565 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911400 10:41306597-41306619 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911551 10:41309660-41309682 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911604 10:41310678-41310700 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911658 10:41311695-41311717 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911708 10:41312714-41312736 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911832 10:41315091-41315113 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911882 10:41316109-41316131 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911936 10:41317126-41317148 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066911988 10:41318146-41318168 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912041 10:41319164-41319186 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912095 10:41320184-41320206 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912143 10:41321204-41321226 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912195 10:41322221-41322243 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912244 10:41323241-41323263 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912294 10:41324257-41324279 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912345 10:41325275-41325297 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912501 10:41328334-41328356 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912557 10:41329355-41329377 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912702 10:41332415-41332437 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912755 10:41333433-41333455 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912856 10:41335471-41335493 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912910 10:41336492-41336514 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066912967 10:41337510-41337532 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913019 10:41338531-41338553 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913072 10:41339548-41339570 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913124 10:41340568-41340590 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913287 10:41343626-41343648 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913493 10:41347701-41347723 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913595 10:41349739-41349761 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913644 10:41350758-41350780 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066913986 10:41357549-41357571 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914044 10:41358568-41358590 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914301 10:41363668-41363690 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066914462 10:41366724-41366746 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914530 10:41368080-41368102 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914579 10:41369099-41369121 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914637 10:41370117-41370139 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914689 10:41371136-41371158 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914844 10:41374193-41374215 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914894 10:41375212-41375234 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914942 10:41376232-41376254 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066914998 10:41377250-41377272 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915048 10:41378267-41378289 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915151 10:41380306-41380328 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915205 10:41381323-41381345 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915305 10:41383360-41383382 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915408 10:41385404-41385426 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915458 10:41386425-41386447 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915511 10:41387445-41387467 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915612 10:41389484-41389506 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915716 10:41391520-41391542 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915769 10:41392537-41392559 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915822 10:41393557-41393579 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066915981 10:41396616-41396638 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916083 10:41398657-41398679 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916192 10:41400695-41400717 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916343 10:41403752-41403774 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916395 10:41404771-41404793 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066916554 10:41407830-41407852 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916744 10:41411565-41411587 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916763 10:41411905-41411927 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
1066916795 10:41412583-41412605 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916865 10:41413938-41413960 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916934 10:41415296-41415318 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066916980 10:41416315-41416337 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917030 10:41417334-41417356 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917188 10:41420391-41420413 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917246 10:41421411-41421433 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917398 10:41424471-41424493 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917466 10:41425828-41425850 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917567 10:41427870-41427892 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917619 10:41428889-41428911 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917669 10:41429908-41429930 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917722 10:41430928-41430950 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917771 10:41431949-41431971 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066917981 10:41436027-41436049 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918033 10:41437047-41437069 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918134 10:41439086-41439108 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918204 10:41440446-41440468 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918255 10:41441465-41441487 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918503 10:41446558-41446580 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918707 10:41450639-41450661 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918761 10:41451660-41451682 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918819 10:41452680-41452702 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066918889 10:41454035-41454057 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919045 10:41457093-41457115 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919098 10:41458113-41458135 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919152 10:41459132-41459154 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919205 10:41460150-41460172 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919361 10:41463210-41463232 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919413 10:41464227-41464249 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919516 10:41466268-41466290 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919666 10:41469330-41469352 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919721 10:41470350-41470372 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919774 10:41471370-41471392 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919826 10:41472389-41472411 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066919981 10:41475447-41475469 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920036 10:41476464-41476486 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920088 10:41477485-41477507 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920139 10:41478503-41478525 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920193 10:41479521-41479543 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920242 10:41480541-41480563 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920291 10:41481560-41481582 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920390 10:41483597-41483619 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920459 10:41484952-41484974 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920565 10:41486990-41487012 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920620 10:41488010-41488032 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920673 10:41489029-41489051 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920722 10:41490048-41490070 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920826 10:41492085-41492107 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066920927 10:41494125-41494147 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921030 10:41496164-41496186 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921065 10:41496845-41496867 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921082 10:41497186-41497208 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921130 10:41498304-41498326 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921236 10:41500338-41500360 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921252 10:41500677-41500699 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921359 10:41502714-41502736 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921375 10:41503054-41503076 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921480 10:41505089-41505111 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921497 10:41505429-41505451 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921599 10:41507466-41507488 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921724 10:41509841-41509863 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921840 10:41512215-41512237 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066921948 10:41514250-41514272 CTTTCTGTGGAATTTGCAAGGGG + Intergenic
1066921965 10:41514590-41514612 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922070 10:41516625-41516647 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922086 10:41516965-41516987 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922193 10:41519000-41519022 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922299 10:41521036-41521058 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922316 10:41521376-41521398 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922422 10:41523411-41523433 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922437 10:41523751-41523773 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922646 10:41527822-41527844 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922662 10:41528162-41528184 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922780 10:41530537-41530559 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066922900 10:41532912-41532934 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923007 10:41534947-41534969 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923022 10:41535287-41535309 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923244 10:41539697-41539719 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923259 10:41540036-41540058 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923365 10:41542071-41542093 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1066923382 10:41542411-41542433 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923485 10:41544446-41544468 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923501 10:41544786-41544808 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923567 10:41546074-41546096 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923588 10:41546412-41546434 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923643 10:41547431-41547453 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923734 10:41549128-41549150 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066923976 10:41553541-41553563 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924033 10:41554561-41554583 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924107 10:41555919-41555941 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924124 10:41556257-41556279 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924180 10:41557277-41557299 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924251 10:41558635-41558657 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924270 10:41558974-41558996 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924306 10:41559654-41559676 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924327 10:41559994-41560016 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924343 10:41560332-41560354 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924399 10:41561352-41561374 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924493 10:41563048-41563070 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924579 10:41564747-41564769 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924600 10:41565087-41565109 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924691 10:41566783-41566805 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924745 10:41567803-41567825 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924763 10:41568141-41568163 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924812 10:41569161-41569183 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924829 10:41569499-41569521 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924886 10:41570519-41570541 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924904 10:41570857-41570879 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924981 10:41572217-41572239 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066924999 10:41572556-41572578 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925055 10:41573576-41573598 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925108 10:41574594-41574616 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925185 10:41575952-41575974 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925205 10:41576292-41576314 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925347 10:41579008-41579030 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925382 10:41579686-41579708 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925458 10:41581043-41581065 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925532 10:41582401-41582423 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925739 10:41586138-41586160 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925757 10:41586476-41586498 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925809 10:41587496-41587518 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925828 10:41587834-41587856 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925897 10:41589192-41589214 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925957 10:41590212-41590234 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066925974 10:41590550-41590572 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1066926049 10:41591908-41591930 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1070402669 10:76067129-76067151 CTTTAAGGGGGAGTCACTAGTGG - Intronic
1070656342 10:78274277-78274299 CTGCCTGGGGAATTTGCTAGAGG + Intergenic
1073247969 10:102105186-102105208 CTCTCAGGGTGAGTTGCTGGTGG + Intergenic
1074554949 10:114480054-114480076 CTGTCAGTGGGATTTGAAAGTGG - Intronic
1079912538 11:26329425-26329447 CTTTTAGGGGAGGTTGCTAGAGG - Intronic
1081671572 11:44945540-44945562 CTTTCCGGGGGAGTTGCCATGGG - Intronic
1081768857 11:45634364-45634386 CTTTCAGTGAGATTTCGTAGTGG - Intergenic
1082316511 11:50731446-50731468 CTTTCTGTGGGATCTGCCAGTGG - Intergenic
1082548521 11:54364414-54364436 CTTTCTGTGGGATTGGCCAGTGG + Intergenic
1082554219 11:54540559-54540581 CTTTCTGTGGGATCTGCAAGTGG + Intergenic
1085137069 11:74101006-74101028 CTTTCAGTGGGGTTTACTAGTGG - Intronic
1085458183 11:76677636-76677658 CCTTCAGAGGGATTGGCTTGGGG - Intergenic
1089473498 11:118739665-118739687 CTTTCAGGGAAATCTGCAAGTGG + Intergenic
1091697835 12:2639958-2639980 CTCTCAGGAGGAATTGCTGGAGG + Intronic
1093872198 12:24306124-24306146 CTTTCAGGAGAATTTTCTATGGG - Intergenic
1094196340 12:27753561-27753583 CTTTGAAGGGGATTTTCTAGAGG + Intronic
1103425745 12:120831845-120831867 CTTTCAGTGGGAATTCGTAGTGG - Intronic
1104637420 12:130447001-130447023 TTTTCAGGGGGATCTGCAGGGGG + Intronic
1105093339 13:16327471-16327493 CTTTCTGGGGAATCTGCAAGTGG + Intergenic
1105107573 13:16560281-16560303 CTTTCTGTGGAATCTGCTAGTGG + Intergenic
1105125085 13:16846295-16846317 CTTTCTGTGGGATCTGCAAGTGG + Intergenic
1105125675 13:16855842-16855864 CTTTCTGGGGAATCTGCAAGTGG + Intergenic
1105126503 13:16869487-16869509 CTTTCTGGGGAATCTGCAAGTGG + Intergenic
1105127522 13:16885859-16885881 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1105147114 13:17205809-17205831 CTTTCTGGGGAATCTGCAAGTGG + Intergenic
1105150027 13:17253578-17253600 CTTTCTGTGGAATCTGCTAGTGG + Intergenic
1105152036 13:17286318-17286340 CTTTCTGGGGAATCTGCAAGTGG + Intergenic
1105154434 13:17325898-17325920 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1107037661 13:35917947-35917969 CTTTCAGGGGCATGAGCTGGCGG - Intronic
1107459605 13:40588688-40588710 CTTTCAGGAAGATTTGGTTGAGG - Intronic
1111431217 13:88150369-88150391 CTTTCAGGGTCATTTGGTTGAGG - Intergenic
1115438594 14:33405657-33405679 TTTTAAATGGGATTTGCTAGAGG - Intronic
1116431413 14:44849451-44849473 GTTTCAGAGGCATTTGCTACAGG - Intergenic
1123385319 15:19791697-19791719 CTTTCAGGAGAATCTGCAAGTGG - Intergenic
1124494731 15:30179450-30179472 CTCTCAGGGGACTTTGCTTGGGG - Intergenic
1124748838 15:32359195-32359217 CTCTCAGGGGACTTTGCTTGGGG + Intergenic
1127997502 15:64162186-64162208 CTTTAAAGGGGCGTTGCTAGGGG + Intronic
1136921191 16:34277610-34277632 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
1137099726 16:36363033-36363055 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137100404 16:36374248-36374270 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137101577 16:36393614-36393636 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137103071 16:36418410-36418432 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137106818 16:36480597-36480619 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137110400 16:36540050-36540072 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137112256 16:36570951-36570973 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137114618 16:36610005-36610027 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137115660 16:36627340-36627362 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137119483 16:36690299-36690321 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137122362 16:36737857-36737879 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137124393 16:36771501-36771523 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137124598 16:36774899-36774921 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137126304 16:36803066-36803088 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137128086 16:36832625-36832647 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137128415 16:36838064-36838086 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137131455 16:36888677-36888699 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137132526 16:36906673-36906695 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137133466 16:36922303-36922325 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137136266 16:36968837-36968859 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
1137141919 16:37062246-37062268 CTTTTAGTGGAATTTGCAAGTGG + Intergenic
1137143191 16:37083320-37083342 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137143971 16:37096230-37096252 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137144072 16:37097929-37097951 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137155363 16:37284370-37284392 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137157563 16:37320729-37320751 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137162088 16:37395785-37395807 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137164232 16:37431461-37431483 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137172812 16:37573136-37573158 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137173019 16:37576531-37576553 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137173954 16:37592159-37592181 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137175977 16:37625452-37625474 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137180881 16:37706629-37706651 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137183168 16:37744335-37744357 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137189174 16:37844201-37844223 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137193704 16:37918927-37918949 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137197449 16:37980724-37980746 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1137203242 16:38076506-38076528 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1145431920 17:22980335-22980357 CTTTCTGTGGGATCTGCAAGTGG + Intergenic
1145457644 17:23343929-23343951 CTTTCAGTGGCATCTGCAAGGGG + Intergenic
1145460740 17:23389054-23389076 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1145461355 17:23398044-23398066 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1145486856 17:23768211-23768233 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1145533441 17:24446311-24446333 CTTTCTGGGGAATCTGCAAGTGG + Intergenic
1145646432 17:26089816-26089838 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1145663147 17:26332304-26332326 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1145685430 17:26654717-26654739 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
1148618315 17:49015968-49015990 CTGTCAGGGAGATTTGTTAGTGG - Intronic
1152489715 17:80621993-80622015 CTTCCACGGGCTTTTGCTAGAGG + Intronic
1157200569 18:45655735-45655757 CTTTCAGGGGGTATTGCGATTGG + Intronic
1164344993 19:27241914-27241936 CTTTCTGAGGGATTTGCAAGTGG + Intergenic
1167758436 19:51427720-51427742 CTTTCACAGGGATTAGCAAGTGG - Intergenic
1168605553 19:57757077-57757099 CTTTCAAGGGCGTATGCTAGAGG - Exonic
925224809 2:2174373-2174395 GTTTCAGGGGCATTTGCCTGAGG - Intronic
925627460 2:5855466-5855488 TTTTCAGTGGGATTTGGTGGAGG - Intergenic
934470835 2:94532634-94532656 CTTTCAGTAGAATTTGCAAGTGG - Intergenic
937030150 2:118732158-118732180 TTTTCAGAGGGATGGGCTAGAGG - Intergenic
937778715 2:125811924-125811946 CTTTCAGAGGGATATGCTCAAGG - Intergenic
939082057 2:137674212-137674234 CTTTAATGGGCATTTGCTAAAGG - Intronic
940505661 2:154549959-154549981 CTTTCAGTGGGATTTGGGAAAGG - Intergenic
945276345 2:207991362-207991384 CTTACATGTGGATGTGCTAGTGG - Intronic
945594663 2:211776804-211776826 CTTTCAGAGGGATATGCTCAAGG + Intronic
1171914192 20:31000036-31000058 CTTTCCGTGGGATTTGCAAGTGG - Intergenic
1172518382 20:35551638-35551660 GTGTCAGGGGGAATTGGTAGGGG + Intronic
1176323551 21:5361018-5361040 CTTTTAGGGTGATCTGCAAGTGG + Intergenic
1176481311 21:7295020-7295042 CTTTTAGGGTGATCTGCAAGTGG + Intergenic
1176762661 21:12971910-12971932 CTTTCAGTAGAATTTGCAAGTGG - Intergenic
1178169251 21:30020423-30020445 ATTTCAGGAGGAATGGCTAGTGG - Intergenic
1178531301 21:33378488-33378510 CTTTCAGTGGGATATGCAATGGG + Intergenic
1180505294 22:15991326-15991348 CTTTCAGGAGAATCTGCAAGTGG - Intergenic
1180985662 22:19902667-19902689 CTTTCAGTGGCATTTGTTACAGG - Intronic
1183581396 22:38728612-38728634 CTTGGAGGGGCATTTGATAGAGG + Intronic
1184817880 22:46885765-46885787 CTTTCACTGGGATGTGCTGGTGG - Intronic
1185241057 22:49747740-49747762 CTTTCAGTGGCATTCTCTAGTGG + Intergenic
1203333366 22_KI270739v1_random:30721-30743 CTTTCAGGAGAATCTGCAAGTGG + Intergenic
955187867 3:56732319-56732341 CTTTCACGGGGATTGGCTGACGG + Exonic
955972879 3:64453289-64453311 CTTTAAGGGGGATGTGTTATGGG - Intergenic
958278917 3:91630047-91630069 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
958336810 3:92578777-92578799 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
958398469 3:93588294-93588316 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
961546150 3:127634899-127634921 AGTGCAGGGGGAATTGCTAGGGG + Intronic
961576732 3:127843084-127843106 CTTTCAGGGGGGTTTAATACGGG - Intergenic
962864641 3:139437602-139437624 TTTTCAAGGAGATTTGTTAGGGG + Intergenic
962865606 3:139445888-139445910 CTTTCAGGGGTTTTTGGTAGTGG + Intergenic
968919545 4:3515448-3515470 CTTTCTGGGGGAGGTGCTAAGGG + Intronic
969860369 4:10031032-10031054 CTTTCAGGGGGCTTAGATTGAGG + Intronic
970003611 4:11388867-11388889 CTTTCAGCTGTATGTGCTAGTGG + Intergenic
971424297 4:26501181-26501203 CTCCCAGGGGGAATTGCTGGAGG + Intergenic
972612923 4:40671810-40671832 CTCTCAGGGGTATTTGCTAATGG - Intergenic
980874175 4:138644232-138644254 CTTTCTGGGAGGTTTTCTAGAGG - Intergenic
984504808 4:180603629-180603651 ATTTCAGGGGAATTTGATATGGG + Intergenic
985174823 4:187189548-187189570 CTTTTAGGGTGCTTTGCTAGGGG - Intergenic
987292943 5:16525209-16525231 CCTGCAGGTGGATTTGCGAGGGG + Intronic
989899871 5:47155052-47155074 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989900038 5:47157772-47157794 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989900197 5:47160493-47160515 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989900359 5:47163214-47163236 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989900681 5:47168653-47168675 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989900850 5:47171374-47171396 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989901013 5:47174095-47174117 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989901180 5:47176816-47176838 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989901344 5:47179536-47179558 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989901489 5:47181917-47181939 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989901655 5:47184637-47184659 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989901821 5:47187357-47187379 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989901986 5:47190081-47190103 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989902150 5:47192799-47192821 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989902312 5:47195518-47195540 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989902463 5:47197898-47197920 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989902630 5:47200618-47200640 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989902795 5:47203338-47203360 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989902963 5:47206056-47206078 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989903127 5:47208777-47208799 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989903349 5:47212513-47212535 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989903493 5:47214893-47214915 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989903690 5:47218295-47218317 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989903853 5:47221014-47221036 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989904001 5:47223394-47223416 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989904170 5:47226114-47226136 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989904347 5:47229001-47229023 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989904511 5:47231721-47231743 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989904673 5:47234442-47234464 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989904837 5:47237161-47237183 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989905083 5:47241240-47241262 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989905250 5:47243959-47243981 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989905420 5:47246675-47246697 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989905570 5:47249055-47249077 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989905735 5:47251775-47251797 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989905903 5:47254494-47254516 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989906071 5:47257216-47257238 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989906234 5:47259936-47259958 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989906402 5:47262656-47262678 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989906565 5:47265377-47265399 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989906729 5:47268099-47268121 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989906901 5:47270821-47270843 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989907067 5:47273542-47273564 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989907228 5:47276262-47276284 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989907394 5:47278983-47279005 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989907555 5:47281702-47281724 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989907721 5:47284421-47284443 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989907886 5:47287142-47287164 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989908209 5:47292581-47292603 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
989908373 5:47295301-47295323 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
990177847 5:53127549-53127571 ATTTCAGAAGGCTTTGCTAGAGG + Intergenic
990403938 5:55468948-55468970 ATTTCAGGGAGGATTGCTAGAGG + Intronic
997306450 5:132840535-132840557 TTATCAGGGACATTTGCTAGTGG - Intergenic
997556633 5:134805141-134805163 CTTTCAGGGGTGTTATCTAGAGG - Intronic
998932017 5:147191444-147191466 GCTTCCGGGGCATTTGCTAGAGG + Intergenic
1001784106 5:174396865-174396887 CTTTAAGAGGGATTTTCAAGAGG + Intergenic
1003871409 6:10405756-10405778 CTTTAATGGGGATATGCTAGAGG + Intronic
1003936150 6:10977024-10977046 CTTTCAGGGGGATTTGCTAGAGG + Intronic
1004231924 6:13841493-13841515 CTTTGAGGGTGACTTGCTTGGGG - Intergenic
1007955634 6:45915432-45915454 CCTTCAGGGGGACTTGACAGGGG + Intronic
1009316579 6:62228292-62228314 CTTTCTAGTTGATTTGCTAGAGG + Intronic
1010726914 6:79345436-79345458 CTTTCTGGAGGATTCTCTAGGGG - Intergenic
1011224410 6:85091177-85091199 CTTTCAGGGGCATTTGAAAAAGG + Intergenic
1013171578 6:107640970-107640992 ATTTCAGGGGGAGTTGCTGAAGG - Intronic
1013275709 6:108582902-108582924 CTTCCTGAGGGATTTTCTAGGGG + Intronic
1016442570 6:144099047-144099069 TTTTCAGGAGGATGTGCAAGAGG - Intergenic
1021478417 7:21088842-21088864 CTTCCAGTGGGACTTTCTAGTGG - Intergenic
1024281171 7:47721110-47721132 CTCGCAGGGGGATTGGCTTGTGG - Intronic
1025323278 7:58172800-58172822 CTTTCTGCGGAATTTGCAAGTGG + Intergenic
1025346864 7:58590764-58590786 CTTTTTGCGGAATTTGCTAGTGG + Intergenic
1025360905 7:58839561-58839583 CTTTTTGCGGAATTTGCTAGTGG + Intergenic
1025379694 7:59172748-59172770 CTTTTTGTGGAATTTGCTAGTGG + Intergenic
1025392633 7:59402674-59402696 CTTTTTGCGGAATTTGCTAGTGG + Intergenic
1025398723 7:59510528-59510550 CTTTTTGCGGAATTTGCTAGTGG + Intergenic
1025401593 7:59561281-59561303 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
1025406235 7:59643370-59643392 CTTTTTGCGGAATTTGCTAGTGG + Intergenic
1025408713 7:59687322-59687344 CTTTTTGCGGAATTTGCTAGTGG + Intergenic
1025424877 7:59974528-59974550 CTTTTTGCGGAATTTGCTAGTGG + Intergenic
1025467508 7:60733268-60733290 CTTTTTGGGGAATTTGCAAGTGG + Intergenic
1025568456 7:62521639-62521661 CTTTTTGTGGGATTTGCAAGTGG + Intergenic
1029193904 7:98791079-98791101 CATTCAGGAGGGTTTGCTGGTGG - Intergenic
1034704292 7:153126932-153126954 ATTTGAGGGGGATTTGATAATGG + Intergenic
1037770992 8:21799743-21799765 ACTTCAGGGGGATTAGCTTGAGG - Intronic
1040142776 8:43944818-43944840 CTTTCTGTAGAATTTGCTAGTGG + Intergenic
1040271440 8:45951015-45951037 CTTTCTGTAGAATTTGCTAGTGG + Intergenic
1041331345 8:56728976-56728998 TTTGCAGGGGAATTTGCTAAGGG + Intergenic
1043803829 8:84645690-84645712 CTTTCAAAGGAATCTGCTAGAGG - Intronic
1043960844 8:86416909-86416931 CTTTCAGGGGGAAGTGGTACAGG - Intronic
1045049070 8:98306554-98306576 GTTTGGGGGGGAATTGCTAGGGG - Intergenic
1045418608 8:101991883-101991905 CTTTCTGAGGGATTTTCAAGAGG - Intronic
1053427226 9:38018138-38018160 CATTTGGGGGGATTTGCTGGCGG + Intronic
1055056442 9:72028602-72028624 CTACCAGGGGGATTTGCTGTGGG - Intergenic
1055394287 9:75857224-75857246 CATGCAGGGGGTTTTGTTAGAGG - Intergenic
1055683515 9:78743679-78743701 CTTTCAGAGGGATATGCTTAAGG + Intergenic
1059645513 9:116262868-116262890 CTTTCAGAAGGATAAGCTAGTGG - Intronic
1061315025 9:129790000-129790022 CTTTCAGGGGGCCTTCCAAGGGG - Intergenic
1061416102 9:130447652-130447674 CTTTCTGGGGGATGTGGTGGGGG + Intronic
1061819979 9:133221937-133221959 GGTTCAGGGGGATTGGGTAGGGG - Intergenic
1203338823 Un_KI270302v1:682-704 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
1203339277 Un_KI270305v1:1178-1200 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
1203340119 Un_KI270320v1:3971-3993 CTTTCAGAGGGACCTGCAAGCGG + Intergenic
1203339402 Un_KI270322v1:1203-1225 CTTTCAGAGGGAACTGCAAGCGG - Intergenic
1203339614 Un_KI270322v1:9939-9961 CTTTCAGTGGGACCTGCAAGCGG - Intergenic
1203339738 Un_KI270322v1:20619-20641 CTTTCAGTGGGACCTGCAAGCGG - Intergenic
1203340968 Un_KI270411v1:1120-1142 CTTTCTGTGGAATTTGCAAGTGG - Intergenic
1203341034 Un_KI270411v1:2477-2499 CTTTCTGTGGAATTTGCAAGTGG - Intergenic
1203340869 Un_KI270412v1:323-345 CTTTCTGTGGAATTTGCAAGTGG - Intergenic
1203341141 Un_KI270414v1:1902-1924 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1203341161 Un_KI270414v1:2242-2264 CTTTCTGTGGAATTTGCAAGTGG + Intergenic
1185560797 X:1059135-1059157 TTTTCAGGGGGGTTAGGTAGAGG + Intergenic
1186640441 X:11449633-11449655 CTTTCAGGGGAACTTGGTAAGGG - Intronic
1187105715 X:16239374-16239396 GTTTCAGGGTGATTCACTAGTGG + Intergenic
1191287001 X:58745636-58745658 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191340635 X:59462048-59462070 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191342075 X:59481008-59481030 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191375655 X:59929898-59929920 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191388448 X:60100819-60100841 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191398855 X:60240344-60240366 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191414386 X:60448749-60448771 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191417332 X:60487829-60487851 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191418568 X:60504287-60504309 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191438133 X:60766793-60766815 CTTTCTGGGGGATCCGCAAGGGG + Intergenic
1191450229 X:60928295-60928317 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191508661 X:61710186-61710208 CTTTCTGGGGGATCCGCAAGGGG + Intergenic
1191510199 X:61730728-61730750 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191510657 X:61736900-61736922 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191513540 X:61775817-61775839 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191514154 X:61784045-61784067 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191517035 X:61822621-61822643 CTTTCTGTGGGATCTGCAAGGGG + Intergenic
1191562161 X:62475772-62475794 CTTTCTGTGGGATCTGCAAGGGG - Intergenic
1198482885 X:137056981-137057003 CTTTCAGTGGAATATGCCAGAGG + Intergenic
1199461939 X:148094413-148094435 CTGGCAGGGGGATTTCCTTGGGG - Intergenic