ID: 1003937611

View in Genome Browser
Species Human (GRCh38)
Location 6:10991858-10991880
Sequence AGTGAAATGGTGACTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 303}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003937611_1003937616 26 Left 1003937611 6:10991858-10991880 CCTTCCACAGTCACCATTTCACT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1003937616 6:10991907-10991929 AATTGAAAGTCTGCTCTGGTAGG No data
1003937611_1003937615 22 Left 1003937611 6:10991858-10991880 CCTTCCACAGTCACCATTTCACT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1003937615 6:10991903-10991925 AAAAAATTGAAAGTCTGCTCTGG No data
1003937611_1003937614 -7 Left 1003937611 6:10991858-10991880 CCTTCCACAGTCACCATTTCACT 0: 1
1: 0
2: 1
3: 40
4: 303
Right 1003937614 6:10991874-10991896 TTTCACTGTGATACAGATTAAGG 0: 1
1: 0
2: 1
3: 11
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003937611 Original CRISPR AGTGAAATGGTGACTGTGGA AGG (reversed) Intronic
901852527 1:12024863-12024885 AGTAGAATGGTGACTGTCCAGGG - Intronic
901986047 1:13076051-13076073 AGTGAAGTGGTCACTGAAGAGGG + Intronic
901995762 1:13150716-13150738 AGTGAAGTGGTCACTGAAGAGGG - Intergenic
902830475 1:19009210-19009232 AGTCAAGTGGTGACGGAGGAAGG - Intergenic
903253290 1:22072693-22072715 AGTGACAGGGTGGCGGTGGAAGG - Intronic
904831985 1:33311311-33311333 AGGGAACAGGTGACCGTGGAGGG - Intronic
905127074 1:35723182-35723204 AGTGAAAGGGTATCTGTGGCTGG + Intronic
906217582 1:44052512-44052534 AAACAAATGGTGACAGTGGAAGG - Intergenic
908109618 1:60883081-60883103 ATAGTAATGGTGACTGTGGCCGG - Intronic
908485581 1:64589205-64589227 ATTGATATAGTCACTGTGGAAGG + Intronic
909973941 1:82023359-82023381 AGTCACATGGTCACTGTGAATGG + Intergenic
910969043 1:92836057-92836079 GGTGAAAGGGTGGGTGTGGAAGG + Intronic
911327630 1:96487567-96487589 ACTGAAATGGTGATTCAGGAAGG + Intergenic
912055477 1:105592925-105592947 ACTGAAGTGGGGGCTGTGGATGG - Intergenic
912754444 1:112312800-112312822 AGGAAAATGTTTACTGTGGAAGG + Intergenic
912799740 1:112713543-112713565 TGTGAAGTGGTGTATGTGGAAGG - Exonic
912852271 1:113137342-113137364 AGTGAAATGGTTACTGAGGCTGG + Intergenic
913256977 1:116962690-116962712 CTTGAAATTGAGACTGTGGAGGG - Intronic
913610988 1:120509614-120509636 AGGGCAATGGTGCCTGAGGAAGG + Intergenic
914235342 1:145805057-145805079 AATGAAATGGTGATGGTAGATGG - Intronic
914580202 1:149012625-149012647 AGGGCAATGGTGCCTGAGGAAGG - Exonic
915565194 1:156709010-156709032 AGGGAAAGGTTGACTGGGGATGG + Intergenic
916433444 1:164754570-164754592 ACTGAAAAAGTGACTGTGTAAGG + Intronic
917140502 1:171830139-171830161 AGAGAAATTGTGTCAGTGGATGG + Intergenic
918087761 1:181259937-181259959 AAAGAAATTGTGCCTGTGGATGG - Intergenic
918427451 1:184425207-184425229 ACTGAGATGGTGTATGTGGAAGG + Intronic
919801005 1:201354628-201354650 TGTGATCTGGGGACTGTGGATGG + Intergenic
923904546 1:238369266-238369288 AGAGAAATGTTAACTGTAGAAGG - Intergenic
1067160491 10:43821224-43821246 AGGGAAATGGCTGCTGTGGAGGG - Intergenic
1067180189 10:43979547-43979569 CCTGAAATGGTGACTGTGGTAGG + Intergenic
1069246778 10:66216960-66216982 AGTGTAGTTGTGACTGTAGAAGG - Intronic
1070538998 10:77402696-77402718 AGTGAAGAGGTGACTGTAGATGG - Intronic
1070572983 10:77655499-77655521 AGTTCATTGGTGTCTGTGGAGGG - Intergenic
1071481762 10:86069984-86070006 CGTGATATGGTGCCTGTAGAGGG + Intronic
1072639328 10:97199617-97199639 AGTGCCTTGGTGACTGTTGAGGG - Intronic
1073543187 10:104328635-104328657 AGTGAAAGGGGGAAAGTGGAAGG - Intronic
1073893179 10:108123738-108123760 ACACAAATGGTGGCTGTGGAAGG + Intergenic
1074908966 10:117890077-117890099 AATGAGATGGTCACTGTGGATGG + Intergenic
1075105301 10:119536341-119536363 GGTGCACAGGTGACTGTGGAAGG - Intronic
1079588682 11:22156103-22156125 AGTGAAATGAAGGCAGTGGAAGG + Intergenic
1080523328 11:33087838-33087860 ACTGAAAAGAAGACTGTGGATGG - Intronic
1080700262 11:34638590-34638612 AGGGACATGGTGTGTGTGGAGGG + Intronic
1080747140 11:35118461-35118483 ACTGACAGGGTGATTGTGGAGGG - Intergenic
1080766828 11:35305056-35305078 GGAGAAATGGTGAATCTGGATGG - Intronic
1080897526 11:36458934-36458956 AGAGATATGGGCACTGTGGAAGG + Intronic
1080954466 11:37077217-37077239 GGTGGAATGGTGAATGTAGATGG - Intergenic
1082180235 11:49108080-49108102 TGTGAATTGGTGAATGTAGAAGG + Intergenic
1082299860 11:50492492-50492514 AGGGAAATGGGGAGTGGGGAAGG - Intergenic
1084635328 11:70388355-70388377 TGTGGATTGGTGACTGTTGAAGG + Intergenic
1084709654 11:70836092-70836114 TGTGAAAGGGTGTCTGTGGCTGG - Intronic
1085141603 11:74148993-74149015 AGAGAAATGGTGTCTATGTAAGG - Intronic
1087290693 11:96317118-96317140 ACTGAAATGGTGCCTGTGGAAGG + Intronic
1087446186 11:98256851-98256873 AGTGAAATGTTGACTGAAAATGG - Intergenic
1088312398 11:108473921-108473943 GGTGGCATGGAGACTGTGGAGGG - Exonic
1088456942 11:110042561-110042583 AGAGAAATGATGTCTGTGTAGGG + Intergenic
1088585456 11:111356774-111356796 AATGAAATAATGAGTGTGGAGGG - Intronic
1089014869 11:115157596-115157618 AGTGGAAGGGGGACTGGGGAGGG + Intergenic
1090480113 11:127060584-127060606 AGTGAATTTTTGACTGTGCAGGG + Intergenic
1090518642 11:127455260-127455282 GGGGAAATGGTCTCTGTGGAGGG + Intergenic
1095520690 12:43061602-43061624 ATTGAAAGGGAGCCTGTGGAAGG - Intergenic
1095667854 12:44823410-44823432 AGTAAAATGGTGATTGCTGAGGG - Intronic
1096258053 12:50074714-50074736 AGTGAAAGGGTGACAGTAGAGGG + Intronic
1096604734 12:52756476-52756498 ATTGAAATGGGAACTGTGGAGGG + Intergenic
1100212308 12:92410154-92410176 AGTGAAAGGGTGAGTGTGGTAGG - Intergenic
1100388480 12:94125898-94125920 AGCGAAATGGTGATTGTTGAAGG + Intergenic
1101041867 12:100763552-100763574 TGTAAACAGGTGACTGTGGATGG - Intronic
1101251305 12:102938874-102938896 AGTGAGAAGGTGGCTGTGGTGGG - Intronic
1101321001 12:103673027-103673049 AATGAGATGGTGCATGTGGAAGG + Intronic
1101916459 12:108899911-108899933 GGTGAAATGGTGAATGGGGTTGG + Intronic
1102287759 12:111673069-111673091 AGGGAAATGTTGACTGTTGCTGG - Intronic
1102876940 12:116456314-116456336 AGAGAAAGGTTGACGGTGGACGG - Intergenic
1103744266 12:123111475-123111497 AATGGAATGGTGGCTGGGGATGG + Intronic
1103923842 12:124413089-124413111 ATTGAAATGGAGGCTGTGGTGGG - Intronic
1104046004 12:125163492-125163514 AGTGAAATGGGGCCGGTGCAGGG - Intergenic
1104516333 12:129430665-129430687 TGTGAAATGGTGACATTAGAGGG + Intronic
1104625472 12:130350295-130350317 AATGAAATGTTGATTATGGAGGG - Intronic
1104702386 12:130917011-130917033 AGTGAAATCGTGTCTCTGGAAGG + Intergenic
1105014364 12:132777155-132777177 TGGGAAATGCTGCCTGTGGAAGG + Intronic
1105293811 13:19071481-19071503 AGAGAAATGGTCACAGTGGAAGG + Intergenic
1105477025 13:20737022-20737044 AGTCAAATGGTGACTGGGCGTGG - Intronic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106181829 13:27375997-27376019 AGGGAAATGGGGAGAGTGGAGGG - Intergenic
1106736917 13:32597400-32597422 AGAGAAATGGTGAGAGTGGCTGG + Intronic
1108868548 13:54952595-54952617 AGTGAATTTTTGACTGTGCAGGG + Intergenic
1110474093 13:75892918-75892940 AGAGAAATGATGACTGTCCATGG + Intergenic
1111177777 13:84619212-84619234 AATGAAATGTTGACAGTGGGAGG - Intergenic
1111324796 13:86680104-86680126 AATAAAATGGTAACTCTGGAAGG - Intergenic
1111431346 13:88151414-88151436 AAGCAAATGGTGACTCTGGAAGG + Intergenic
1111678774 13:91418582-91418604 AGTGATGGGGTGAGTGTGGAAGG + Intronic
1113395132 13:109940463-109940485 AGTGAGGGCGTGACTGTGGAGGG - Intergenic
1114131096 14:19793842-19793864 AGTGAATTAGTGCCTGTGAATGG + Intronic
1116385966 14:44330259-44330281 AGTTAAAGGGGGAGTGTGGAAGG - Intergenic
1117297918 14:54395924-54395946 AGTTAAATGGGGACTGGAGAAGG + Intergenic
1118171405 14:63392912-63392934 AGTGACATGGTGACCATGCAAGG + Intronic
1119977362 14:79040064-79040086 AGCGAGATGGGAACTGTGGAAGG - Intronic
1120414336 14:84200398-84200420 TGTGAAACGGTGACGGGGGAAGG + Intergenic
1120853488 14:89192132-89192154 TGGGAAATGGTGACTGTTTAAGG - Intronic
1123574154 15:21649451-21649473 AGTGAATTAGTGCCTGTGGATGG + Intergenic
1123610770 15:22092036-22092058 AGTGAATTAGTGCCTGTGGATGG + Intergenic
1124063711 15:26319910-26319932 AGTGAAGTGGTCACAGAGGAAGG + Intergenic
1125967985 15:43889588-43889610 AGTGACATGGTTACTGTACATGG + Intronic
1126430946 15:48583729-48583751 AATGTAATGGTGACTGTGTCTGG - Intronic
1126530622 15:49706987-49707009 AGTGAAATGGGGAGAGAGGAAGG - Intergenic
1126666322 15:51078658-51078680 AGAGAAATGTTGAATGTGGAGGG - Intronic
1126861285 15:52885447-52885469 AGTGAAATAGAGACAGTTGAAGG - Intergenic
1126879174 15:53076176-53076198 AGTCAAACGCTGACTGTGGCTGG - Intergenic
1127729222 15:61783315-61783337 TAGGGAATGGTGACTGTGGAGGG - Intergenic
1127997469 15:64161982-64162004 AGTGAAATTGGCACTGGGGATGG - Intronic
1130114253 15:80992569-80992591 AGTGATTCAGTGACTGTGGATGG + Intergenic
1130174225 15:81550841-81550863 AATAAAATGTTTACTGTGGAAGG - Intergenic
1130411532 15:83653037-83653059 AAGGAAATGGCGACTGTGGTAGG + Intergenic
1131222021 15:90592744-90592766 AGTGAAATGGTTTGTGTGTAAGG + Intronic
1131598511 15:93823891-93823913 AGGGAAGTGGGGACAGTGGATGG + Intergenic
1132302612 15:100785466-100785488 AGGGAAATGGTGACTTCAGAAGG + Intergenic
1202983018 15_KI270727v1_random:383795-383817 AGTGAATTAGTGCCTGTGGATGG + Intergenic
1132928631 16:2446840-2446862 AGTGCAAAGGTGAATGTGGCAGG - Intronic
1134052947 16:11149846-11149868 AGGCAAATGATGACTGAGGAAGG - Intronic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1138382303 16:56611127-56611149 AGTGAAAGAGTGACCGTGCAGGG + Intergenic
1139100730 16:63763170-63763192 AGAGAAAAAGTCACTGTGGAAGG + Intergenic
1142011638 16:87718362-87718384 AGGGAGAGGGAGACTGTGGAGGG - Intronic
1144036028 17:11366794-11366816 GGAGAAATGGTGTATGTGGAGGG + Intronic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1144723079 17:17485685-17485707 AATGACTTGGTAACTGTGGAGGG + Intronic
1146053438 17:29569159-29569181 CCTCAGATGGTGACTGTGGAGGG - Intronic
1146233952 17:31139975-31139997 AGTAAAAAGGTGATTGTTGAGGG + Intronic
1147749232 17:42718392-42718414 AAGGAAATGGTGGCTGGGGATGG + Intronic
1147751360 17:42736222-42736244 AGTGATATAGCCACTGTGGAAGG + Intronic
1147891402 17:43720031-43720053 ACCGAAGTGGTGGCTGTGGAGGG + Intergenic
1147914289 17:43877420-43877442 GGAGAACTGGTGACTGGGGAGGG + Intronic
1149784367 17:59422879-59422901 AGGGAAAAGGTGACACTGGAAGG + Intergenic
1150973666 17:70059369-70059391 AATGAAATGGTGAGAGTTGAAGG + Intronic
1152637197 17:81435030-81435052 AGAGAAATGGGGGCTGGGGACGG - Intronic
1152651791 17:81498127-81498149 AGTGAAATGGTGGCTGCCGGGGG + Intergenic
1153396337 18:4625605-4625627 AGTGAAATGGACTCTGTTGAGGG + Intergenic
1154409797 18:14132261-14132283 CGAGAAATGGTGAGTGTGGGGGG - Exonic
1155680162 18:28477732-28477754 AAATAAATGGTGACTGTGGAAGG - Intergenic
1155755413 18:29489051-29489073 ACAGAAATGAGGACTGTGGAAGG - Intergenic
1155811998 18:30248806-30248828 AGAGAAATTGAGACTGTGAAAGG - Intergenic
1155890049 18:31256440-31256462 TGTGAAATAGTGACTATGAAGGG - Intergenic
1157181204 18:45499836-45499858 AATGAAATAATGAATGTGGAGGG + Intronic
1157375832 18:47163959-47163981 TGCGAAATTGTGGCTGTGGATGG - Intronic
1157512052 18:48282862-48282884 ACTGAAATGGGGCCTGAGGATGG + Intronic
1157928424 18:51791660-51791682 AGTGATATGTGGACTGGGGATGG - Intergenic
1158234259 18:55295406-55295428 ATTGAAGTAGTGAGTGTGGAAGG - Intronic
1160157607 18:76445452-76445474 AGTGAACTGGGGCCTGGGGAAGG - Intronic
1160386184 18:78498261-78498283 AGTGAAATGGTGAGGACGGAGGG + Intergenic
1160437606 18:78863296-78863318 TGTTATATGGTGGCTGTGGACGG - Intergenic
1160982642 19:1823396-1823418 TGTGAAATGGGGACTGTTGAGGG - Intronic
1161726574 19:5932819-5932841 AGTCAAGTGGAGACTGTGGGAGG + Intronic
1162113947 19:8416943-8416965 AGTGAGATGATGACTATGTATGG + Intronic
1162246458 19:9405704-9405726 AAACAAATGGTAACTGTGGAAGG + Intergenic
1162668760 19:12237438-12237460 CGGGAAATGGTGAGTGTGCAAGG - Intronic
1163172008 19:15537840-15537862 AGATACATGGTGACTGTGCATGG - Intronic
1163510749 19:17733676-17733698 AGTGACAAGGTGTCTGGGGAAGG - Intronic
1164871616 19:31650043-31650065 TGTGAAATGATGTCTGTGCAAGG + Intergenic
1166026443 19:40090307-40090329 AGGGAAATTGTGGCTATGGAGGG - Intronic
1166072253 19:40394309-40394331 AGTGAGATGGTCACTGGGGAAGG - Exonic
1168340525 19:55620815-55620837 AGTGAAAGAGTCACTGTGGTGGG - Exonic
1168654765 19:58118872-58118894 AGTAAAATGGTTATTGTGCACGG - Intergenic
928213140 2:29338880-29338902 ATTGAAATGGAGACTGGGGAAGG - Intronic
928269362 2:29842511-29842533 AGTGAAGTGGTAACTGTGTGGGG - Intronic
929843369 2:45495453-45495475 AGTGAGATGCTTACTGTGGAAGG - Intronic
929992644 2:46802722-46802744 AGTGAAATGAAGATTGAGGATGG - Intergenic
930566646 2:53028882-53028904 TGTGAGATGGAGCCTGTGGAGGG + Intergenic
935827494 2:106965975-106965997 GGTGAAATGCTGTGTGTGGAGGG + Intergenic
937237557 2:120439976-120439998 GGTGAAATGTTGACTGAGGCTGG + Intergenic
937611556 2:123867945-123867967 AATGAAATTGTGACTGAGAAAGG + Intergenic
940662988 2:156570831-156570853 AGGTAAGTGATGACTGTGGATGG + Intronic
941782615 2:169461059-169461081 ATAAAAATGGTGACTGGGGAGGG + Intergenic
942177409 2:173347269-173347291 AGTGACAGGGAAACTGTGGATGG + Intergenic
943732731 2:191320040-191320062 AAGGAAAGGGTGACTTTGGAAGG + Intronic
944548504 2:200822469-200822491 AGTGAACTGTTCATTGTGGAAGG - Intronic
945213637 2:207410369-207410391 AGTGAAATGGTAGCTGTGCAGGG - Intergenic
947769178 2:232657239-232657261 AGTAGAATGGTGACTGTCAAGGG - Intronic
948882263 2:240865655-240865677 AGTGATATTGTAAGTGTGGATGG - Intergenic
949073949 2:242043304-242043326 AATGAAATTGTGACTATAGAAGG - Intergenic
1168893453 20:1308650-1308672 AGGAAAAGGGTCACTGTGGAGGG - Exonic
1170635172 20:18098210-18098232 CGGGAAATGGTGACAGTGGATGG - Intergenic
1170758791 20:19230748-19230770 TGTGACATGCGGACTGTGGAAGG - Intronic
1170767205 20:19300423-19300445 AGTCAGGTGGTGACTGAGGATGG - Intronic
1170802050 20:19598610-19598632 AGTGAAATTGTGACTGCAGTTGG + Intronic
1171878409 20:30598877-30598899 AGAGAAATGGTCACAGTGGGAGG + Intergenic
1173941344 20:46913782-46913804 GCTGAAATGGGGACAGTGGAGGG + Intronic
1173993468 20:47320337-47320359 TGTGACAAGGTGACTGTGGAGGG - Intronic
1174867275 20:54149732-54149754 AGTGGAAAGATGACTATGGAAGG + Intergenic
1175541992 20:59753825-59753847 AGTGAAAGGGACACTGTTGAAGG + Intronic
1175658292 20:60791016-60791038 CATGAAATGGTGACTGCAGAAGG + Intergenic
1175934546 20:62509054-62509076 GGTGAAAGGGTGAGGGTGGAGGG - Intergenic
1176863427 21:14027589-14027611 CGAGAAATGGTGAGTGTGGGGGG + Intergenic
1177140264 21:17350807-17350829 AGTGGTATGGTAACTGTGGTAGG - Intergenic
1177393749 21:20507902-20507924 AGTGCAGCTGTGACTGTGGAAGG - Intergenic
1178095644 21:29212306-29212328 GGTTAAATGGAGACTATGGAAGG - Intronic
1178525628 21:33325898-33325920 ATTGACATGGTCAGTGTGGAAGG + Intronic
1179038324 21:37779495-37779517 AGTGCAATGGGGTCTATGGATGG - Intronic
1179901447 21:44396488-44396510 AGGGATGTGGAGACTGTGGAAGG + Intronic
1180008081 21:45032569-45032591 AGTGACACGGTGACTGAGGCTGG - Intergenic
1182220428 22:28754283-28754305 AGTGGAATGGTGGTTGTGGGGGG + Intronic
1183001000 22:34859027-34859049 ACAGAAATAGTGACTATGGAGGG - Intergenic
1183118296 22:35709072-35709094 AGTCAAAAGATGAGTGTGGATGG + Intergenic
1183741331 22:39670230-39670252 AGTGAGTGGGTGCCTGTGGAGGG + Exonic
1184554216 22:45224644-45224666 AGTGAGATGGTAGCTGTGGCAGG + Intronic
949135320 3:558099-558121 AGTGAAAATGTTTCTGTGGAAGG + Intergenic
949395116 3:3606679-3606701 GGTGAAATGGGGAGTGTGGAAGG - Intergenic
950709746 3:14805765-14805787 AGGGAAATGGTGTCTGAGCAAGG - Intergenic
951185218 3:19704745-19704767 AGTAAAATGATAACTTTGGATGG - Intergenic
951280897 3:20748137-20748159 ACTGATGTGGAGACTGTGGAAGG + Intergenic
954508877 3:51104374-51104396 AGTGAAATGGGGACCATTGAAGG + Intronic
956298856 3:67746710-67746732 ACTCAAAAGGTTACTGTGGATGG - Intergenic
958135196 3:89479527-89479549 ACGGAAGTGGTGGCTGTGGAAGG + Exonic
959412415 3:106041106-106041128 ATTGAAATGGTTAGTGTGGTAGG - Intergenic
959572631 3:107900937-107900959 ACTAAACTGGTCACTGTGGATGG - Intergenic
960355332 3:116645584-116645606 AGTGAACTGTTCATTGTGGAAGG + Intronic
961734491 3:128993063-128993085 AGTGAGATGGTGAATTTGCAGGG + Exonic
962477088 3:135764511-135764533 AGTGAAAGTGGGACTGAGGATGG - Intergenic
963988563 3:151626811-151626833 AGTGAAATGGTGAGTGGAGAAGG + Intergenic
964641632 3:158915214-158915236 AAACAAATGGCGACTGTGGAAGG + Intergenic
965237899 3:166151017-166151039 AGTGAAATGAGGAATGTGGGAGG - Intergenic
965486736 3:169287150-169287172 AGTGAAATGGTGACTTGTAAAGG - Intronic
965794486 3:172425535-172425557 AGTGAACTGTTCATTGTGGAAGG + Intergenic
966715663 3:183010999-183011021 AGTGAGAAGTTGATTGTGGAGGG + Intergenic
967477102 3:189934910-189934932 GGTGGAATGGTTACAGTGGATGG + Intergenic
968384540 4:124665-124687 CGGGAAATGGTGAGTGTGCAGGG + Exonic
969131083 4:4991521-4991543 TGTGAAAGGGTGAGTGTGGGTGG - Intergenic
969917603 4:10506012-10506034 AGTACAATGGTCACTGTTGAAGG - Intronic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972255994 4:37356112-37356134 AATGAAATGCTAACTGTTGAAGG - Intronic
972419139 4:38869815-38869837 TATGAAATAGTGACAGTGGATGG - Intronic
972848261 4:43016278-43016300 AGGGAAATGGTGACTACGAAAGG + Intronic
973951878 4:56023494-56023516 AGGCTAATGGTGACTATGGAGGG - Intronic
974087381 4:57275987-57276009 AGTGAAAAGTTGAGTGAGGATGG - Intergenic
974227384 4:59064517-59064539 AGTGGAATAGAGACTATGGAGGG + Intergenic
974716487 4:65674861-65674883 AGAGACATGGTGATTGTTGATGG + Intergenic
975023540 4:69520726-69520748 AGCTAAATGGGGACTGAGGATGG + Intronic
977152789 4:93534021-93534043 AGTGAAAAGGGGAGTGTGGTTGG - Intronic
977189595 4:93983121-93983143 AGTGAAAGGTTGACAGTGAAAGG - Intergenic
979569253 4:122198173-122198195 ATTGAAAAAGTGACTGTGAATGG + Intronic
980843758 4:138299408-138299430 ATTGAAATCATGACTGTGGAAGG - Intergenic
981054813 4:140349849-140349871 AGTGATGTGGCCACTGTGGAGGG - Intronic
981720543 4:147797336-147797358 AGTAAAATGGTGGCAGTGGAAGG - Intronic
982232728 4:153223519-153223541 AGGGAGATGGTGACTTTTGAGGG + Intronic
983031506 4:162808361-162808383 AGTAAAATTGTGACTGTTTATGG + Intergenic
984567846 4:181352335-181352357 AGTGAAATGGTTACTTGGCATGG - Intergenic
984602575 4:181745384-181745406 AATGAAATGGTAGCTGTAGACGG + Intergenic
985684069 5:1272526-1272548 TCTGATGTGGTGACTGTGGATGG - Intronic
985684076 5:1272560-1272582 TCTGATGTGGTGACTGTGGATGG - Intronic
985684082 5:1272594-1272616 TCTGATGTGGTGACTGTGGATGG - Intronic
985684117 5:1272772-1272794 TCTGATGTGGTGACTGTGGATGG - Intronic
985684131 5:1272842-1272864 TCTGATGTGGTGACTGTGGATGG - Intronic
985684191 5:1273141-1273163 TCTGATGTGGTGACTGTGGATGG - Intronic
985684219 5:1273283-1273305 TCTGATGTGGTGACTGTGGATGG - Intronic
985684233 5:1273353-1273375 TCTGATGTGGTGACTGTGGATGG - Intronic
985684272 5:1273541-1273563 TCTGATGTGGTGACTGTGGATGG - Intronic
985684279 5:1273575-1273597 TCTGATGTGGTGACTGTGGATGG - Intronic
985684304 5:1273686-1273708 TCTGATGTGGTGACTGTGGATGG - Intronic
985684311 5:1273720-1273742 TCTGATGTGGTGACTGTGGATGG - Intronic
988203233 5:28097171-28097193 AATGAAATGGTGGCTGGGGATGG - Intergenic
988225994 5:28412013-28412035 AAATAAATGTTGACTGTGGAAGG + Intergenic
989576203 5:42990938-42990960 TGGGAAATGATGAGTGTGGATGG + Intergenic
991347495 5:65685070-65685092 AGTGGAAAGGTGACTATAGAAGG + Intronic
991354258 5:65751212-65751234 AGTGACATGGTGACAGGGAAAGG + Intronic
991941609 5:71858434-71858456 ACGGAAATGGTGACTGGGAAAGG + Intergenic
992715005 5:79501778-79501800 AGGGAAATTGTGACTATGGGAGG - Intronic
992800656 5:80292807-80292829 AGTGAACCTGTGTCTGTGGATGG + Intergenic
992972656 5:82078659-82078681 AGTGAGATGGAGCCTGTGAATGG + Intronic
996819254 5:127607754-127607776 AGTGAAATTGTGACAGTGTAGGG - Intergenic
1001094242 5:168763778-168763800 AGTGAAATGTTGAGTGTGAAAGG - Intronic
1001166674 5:169374793-169374815 AGTGAAATGGACTCTCTGGAGGG - Intergenic
1001254977 5:170176531-170176553 AGTCAAATGGTGGCTGTGGCTGG + Intergenic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1003937611 6:10991858-10991880 AGTGAAATGGTGACTGTGGAAGG - Intronic
1003937899 6:10994657-10994679 GGGGAAGTGGTGACTGTGGAAGG + Intronic
1004516940 6:16328324-16328346 AGTGAAACAGTCACCGTGGAGGG - Exonic
1006039517 6:31242565-31242587 AGTGAAATTGTGGCTGTAGATGG + Intergenic
1006048382 6:31319188-31319210 AGTGAAATTGTGGCTGTAGATGG + Intronic
1008489381 6:52069762-52069784 AATGAAATGATGAGTGTGAAAGG + Intronic
1008966025 6:57313633-57313655 AGTGAAATGGGGAGGGTGGAGGG + Intergenic
1009574877 6:65439941-65439963 AGATAAAAGGTGACAGTGGAGGG + Intronic
1009653811 6:66513276-66513298 AGTGGAATGGTGACTATGAGAGG + Intergenic
1011489702 6:87878086-87878108 ACTGAAATGGTGATTGTGTTTGG + Intergenic
1013479698 6:110543200-110543222 AGGGCAATGGGGCCTGTGGATGG + Intergenic
1013490227 6:110639771-110639793 AGGGAAATGCTCACTGGGGATGG + Intronic
1013744408 6:113327859-113327881 AGGTAAATGGAGACTTTGGATGG + Intergenic
1014072012 6:117193205-117193227 AGTGAAATGGTGAATGGTTAAGG - Intergenic
1014437734 6:121438841-121438863 AGTTAAAAGGTGACTTTAGATGG - Intronic
1017598064 6:156050697-156050719 ACTGAAACGGTGTCTGTGGTGGG + Intergenic
1018763394 6:166909919-166909941 AGTGAAATGAGGCCTATGGATGG + Intronic
1019704887 7:2492851-2492873 AGAGTTATGGGGACTGTGGAGGG + Intergenic
1022544915 7:31177492-31177514 AGAGCAAATGTGACTGTGGAGGG + Intergenic
1023491735 7:40750193-40750215 AGAGAAATGGAGGCTGTGGGAGG - Intronic
1024920127 7:54546219-54546241 AGGGGAATGGGGAGTGTGGAGGG + Intronic
1025910017 7:65820681-65820703 ACTGAAATGGGAACTGTGGGTGG + Intergenic
1026538680 7:71261608-71261630 CGTGAAATGGAGACCCTGGAAGG + Intronic
1026661688 7:72308348-72308370 AGTGAGATGCTGTCTGTGGGGGG + Intronic
1026863481 7:73809043-73809065 AGGGAAATGGCAACTGGGGAGGG - Intronic
1029618100 7:101672554-101672576 AGAAAAATGGGGCCTGTGGAAGG - Intergenic
1029926678 7:104326659-104326681 AGTGCATTGGTGGCAGTGGAGGG - Intergenic
1030222314 7:107109993-107110015 ACTGAAATGGCCACTGAGGAGGG + Intronic
1031469319 7:122150235-122150257 AGTGAAATGACTACTGTGAAAGG - Intergenic
1031493092 7:122413120-122413142 AGCAAAATGGTGTGTGTGGAGGG + Intronic
1034537327 7:151733690-151733712 AAAAAAATGGTGACTGTGCACGG - Intronic
1037409577 8:18582250-18582272 AGTGCAGTGGTGAGCGTGGAAGG - Intronic
1037430906 8:18812374-18812396 AGTGAAATGGTTAATATTGAAGG + Intronic
1037432084 8:18824292-18824314 AGTGGAATGTTTACTGTGGAAGG - Intronic
1038506970 8:28092844-28092866 AGTGAAAGGGTGGAAGTGGATGG - Exonic
1038650045 8:29394329-29394351 AGTGGAATGGTAACTGAGAAAGG - Intergenic
1038992640 8:32885743-32885765 AGTAAAATGGTACATGTGGAAGG - Intergenic
1039778271 8:40758308-40758330 TGTGGAGTGGTGACTGTGGAGGG - Intronic
1039996512 8:42539007-42539029 AGTGAATTTGTGACTGGAGATGG - Intronic
1040012520 8:42674308-42674330 ACTCACATGGTGACTGGGGAAGG - Intergenic
1041938230 8:63358155-63358177 AATGAAAGGAAGACTGTGGAAGG - Intergenic
1042639373 8:70916363-70916385 AGTGCAATGGAGAATGTGCAGGG - Intergenic
1042778803 8:72467224-72467246 ATTGAAAGGATGACTGAGGATGG - Intergenic
1043355057 8:79402142-79402164 AGAGAAATGGTGACCGTGTGGGG + Intergenic
1044244658 8:89928494-89928516 AGAGAAATGGTGTCTGGGGAAGG + Intergenic
1044312800 8:90713599-90713621 AGTGAAATAGGTACTGTGGAGGG - Intronic
1044436589 8:92171269-92171291 AGTGGAGTGGTGAGTGTGTAAGG - Intergenic
1045951801 8:107860075-107860097 AGTGAAAGGATAACTGGGGAGGG + Intergenic
1046524070 8:115361511-115361533 TCTGGAAAGGTGACTGTGGATGG - Intergenic
1047369919 8:124247633-124247655 AGTGAAATGGGGATTGTTGTGGG - Intergenic
1049210593 8:141384800-141384822 AGGGAGATGGCAACTGTGGATGG + Intergenic
1050884643 9:10748790-10748812 AGTGAAATGATGACTTTGCCAGG - Intergenic
1051046135 9:12876007-12876029 AGTGGAATGGTGATTGCCGAGGG + Intergenic
1053144701 9:35704511-35704533 TGTCACATGGTGACTGTGGAAGG + Intronic
1054944119 9:70776400-70776422 AGTGAAATGGTGCTAGTTGATGG - Intronic
1055404219 9:75957599-75957621 GCTGAAATGGTGACTGTAGTAGG + Intronic
1056135849 9:83628838-83628860 AGTGAAAGGGTGTATGTGGCAGG - Intronic
1058172165 9:101694759-101694781 AGTCATATGGTGACTTAGGAGGG + Intronic
1060209366 9:121700371-121700393 AGTGGAAAGGTGCCTGTGGCTGG - Intronic
1060269076 9:122128451-122128473 TGTGGAGTGGGGACTGTGGAGGG - Intergenic
1061699082 9:132401707-132401729 AGTGAGGTTGGGACTGTGGAAGG - Exonic
1062523940 9:136970727-136970749 AGGGACATGGTGGCTGTGGCTGG + Intronic
1187720730 X:22148165-22148187 AGTCAGATGGTGGCTGTGGCTGG + Intronic
1188308687 X:28589650-28589672 ATTGAAATGATGACTGTGAACGG + Intronic
1190405570 X:50083836-50083858 AGTGAAGTGGTGATTGTTGCTGG + Intronic
1193295312 X:79826230-79826252 AGTGTACTGGTGAATGAGGATGG - Intergenic
1194284941 X:91998639-91998661 AGAGAAATGGTTAGTCTGGATGG - Intronic
1194571617 X:95560318-95560340 TAAAAAATGGTGACTGTGGAAGG + Intergenic
1195134863 X:101894892-101894914 AGTGAGAAGGTGCCTGTGGGGGG + Intronic
1198972854 X:142301028-142301050 GGTGAAATGGTGAGTTTGGCAGG - Intergenic
1200085458 X:153602188-153602210 AGTGGAGAGGTGACTGTGGCAGG - Intergenic
1200602509 Y:5223201-5223223 AGAGAAATGGTTAGTCTGGATGG - Intronic
1201245953 Y:12003925-12003947 AATTAAATGGTGACAATGGATGG - Intergenic
1201640739 Y:16174095-16174117 TGTGAAATAATAACTGTGGAAGG + Intergenic
1201662076 Y:16411231-16411253 TGTGAAATAATAACTGTGGAAGG - Intergenic