ID: 1003939056

View in Genome Browser
Species Human (GRCh38)
Location 6:11006041-11006063
Sequence CAGAGCAGTCAGAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 5, 3: 103, 4: 684}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003939051_1003939056 6 Left 1003939051 6:11006012-11006034 CCTTGCAGCTGTCCTCCCATGGA 0: 1
1: 0
2: 0
3: 20
4: 234
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939054_1003939056 -10 Left 1003939054 6:11006028-11006050 CCATGGAGAAGATCAGAGCAGTC 0: 1
1: 0
2: 0
3: 20
4: 206
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939047_1003939056 16 Left 1003939047 6:11006002-11006024 CCCCATGATACCTTGCAGCTGTC 0: 1
1: 0
2: 1
3: 6
4: 153
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939045_1003939056 21 Left 1003939045 6:11005997-11006019 CCCAGCCCCATGATACCTTGCAG 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939046_1003939056 20 Left 1003939046 6:11005998-11006020 CCAGCCCCATGATACCTTGCAGC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939052_1003939056 -6 Left 1003939052 6:11006024-11006046 CCTCCCATGGAGAAGATCAGAGC 0: 1
1: 0
2: 1
3: 23
4: 157
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939053_1003939056 -9 Left 1003939053 6:11006027-11006049 CCCATGGAGAAGATCAGAGCAGT 0: 1
1: 0
2: 2
3: 15
4: 368
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939048_1003939056 15 Left 1003939048 6:11006003-11006025 CCCATGATACCTTGCAGCTGTCC 0: 1
1: 0
2: 0
3: 8
4: 87
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939049_1003939056 14 Left 1003939049 6:11006004-11006026 CCATGATACCTTGCAGCTGTCCT 0: 1
1: 0
2: 0
3: 20
4: 205
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684
1003939044_1003939056 24 Left 1003939044 6:11005994-11006016 CCTCCCAGCCCCATGATACCTTG 0: 1
1: 0
2: 2
3: 11
4: 178
Right 1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG 0: 1
1: 0
2: 5
3: 103
4: 684

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003939056 Original CRISPR CAGAGCAGTCAGAGGAAAGA AGG Intronic
900214858 1:1475958-1475980 CAGAGCAGTGACAGGAACGTGGG - Intronic
900222071 1:1514312-1514334 CAGAGCAGTGACAGGAACGTGGG - Intronic
901237743 1:7676498-7676520 CAGAGTCCTCGGAGGAAAGATGG + Intronic
902752145 1:18524142-18524164 CACAGCAGGCAGAGGCCAGAAGG - Intergenic
903352622 1:22727168-22727190 CAGAGCAGGGAGAGGCAAGCTGG + Intronic
903537795 1:24078531-24078553 GGGAGCACCCAGAGGAAAGAAGG - Intronic
903777964 1:25805345-25805367 CACAGAGGGCAGAGGAAAGATGG - Intronic
904146238 1:28394326-28394348 CAGAGCAGAGAGAGAAAGGAAGG + Intronic
904360261 1:29966601-29966623 AAGAGCTGAAAGAGGAAAGAAGG + Intergenic
904431574 1:30467963-30467985 GAGAGCAGTCCCAGGAAAGCGGG - Intergenic
904999032 1:34653667-34653689 AAGAGCAGTCATATGAAGGAGGG + Intergenic
905905398 1:41614771-41614793 TACAGCAGTCAGAGGAAGAAGGG + Intronic
906459929 1:46029374-46029396 CAGAACAGTGAAAGGAAAGGAGG - Intronic
906693942 1:47811455-47811477 CTAAGCATTCAGAGAAAAGAAGG - Intronic
907326191 1:53640104-53640126 CAAAGCAGTCAGAGGAGTGCAGG + Intronic
907334111 1:53689272-53689294 CAGCCCAGTCAGAGGGAAGGAGG + Intronic
907830819 1:58062537-58062559 CAGAGCAGCAAGATGAAAAATGG - Intronic
908006298 1:59732637-59732659 CAAAGCAGATAGAGGAAAGGGGG + Intronic
908414367 1:63898624-63898646 GAAAGGAGACAGAGGAAAGAAGG + Intronic
908449733 1:64240447-64240469 CACAGCAGTCAGATTAAGGAAGG + Intronic
908487324 1:64607467-64607489 GAGAGGAGTCAGAGGAAATAAGG + Intronic
908837841 1:68245826-68245848 CAGAGCAGTCAGTAGAATGCTGG - Intergenic
908842768 1:68295633-68295655 CGGGGCAGTCAGAGGAGAGCGGG - Intergenic
908859760 1:68470881-68470903 CTGAGCAATCAGAAGACAGATGG + Intergenic
909003145 1:70243133-70243155 TACATCAGTAAGAGGAAAGAAGG + Intronic
909298841 1:73985017-73985039 CAGAGCACTCAGACAAGAGAAGG - Intergenic
909456404 1:75854576-75854598 CAGAGCAGGGAGAGGACGGACGG - Intronic
909742295 1:79045433-79045455 CGGGGCAGTCAGAGGAAAGCTGG - Intergenic
909806597 1:79880302-79880324 CAGAGCAGTCAGGCAAGAGAAGG + Intergenic
910095655 1:83518901-83518923 CAGATCAGACAGAGAATAGAGGG + Intergenic
910307477 1:85782724-85782746 AAGAGCAGAGAGAGGAAAAAGGG - Intronic
910447742 1:87315957-87315979 TGGAGCAGACAGATGAAAGATGG - Intergenic
910718957 1:90264125-90264147 CAGAGCTATCTGAGGAACGAGGG + Intergenic
910870771 1:91830778-91830800 CAGAGCAGTGAGAGGGCACAGGG + Intronic
911677225 1:100672938-100672960 CAAAAGAGTCAGAGGAATGAAGG + Intergenic
911780878 1:101876370-101876392 ACGAGCACTCAGAGAAAAGATGG + Intronic
911805857 1:102207319-102207341 CAGAGCAATCAGACAAGAGAAGG - Intergenic
913283029 1:117203478-117203500 CACAGCGGTCATGGGAAAGAGGG - Intronic
913410270 1:118543035-118543057 CAGAGCATTGAGAGGAAACATGG + Intergenic
913972723 1:143426828-143426850 CAGAACAATCAGACAAAAGAAGG - Intergenic
914067107 1:144252442-144252464 CAGAACAATCAGACAAAAGAAGG - Intergenic
914112046 1:144713912-144713934 CAGAACAATCAGACAAAAGAAGG + Intergenic
914357861 1:146903288-146903310 CAGAGCAGTGGGGGAAAAGATGG - Intergenic
915100372 1:153495039-153495061 GAGGGCAGGCAGAGGAAGGAGGG - Intergenic
915930028 1:160054661-160054683 CAGAGCTGACACAGGAAGGAGGG - Intronic
915950015 1:160183467-160183489 CAGGGGAATCAGAGAAAAGAGGG - Intronic
916734322 1:167594014-167594036 CTGAGGAGTCAGGGGTAAGAGGG - Intergenic
916786113 1:168088254-168088276 CAGAGCAGGCAGAGGGAATGGGG + Intronic
917068845 1:171127204-171127226 TAGAGAAGTCAGAGGCAATATGG - Intergenic
917386768 1:174485332-174485354 TAGAGCAGTCAGAAAAGAGAAGG - Intronic
917773339 1:178304799-178304821 TAGAGCAGTCAGACAAGAGAAGG + Intronic
917898129 1:179513054-179513076 CAGAGCAATCAGACAAGAGAAGG - Intronic
918247059 1:182669786-182669808 TAGTGCAGTCAGATGAGAGAGGG - Intronic
918279035 1:182984909-182984931 TAGAGCAGTAAGAGGGAAAATGG - Intergenic
918677480 1:187305456-187305478 CAGAGCAATCAGGGAAGAGAAGG + Intergenic
919113933 1:193257558-193257580 CATAGGAGTGAGAAGAAAGATGG + Intergenic
919536779 1:198797195-198797217 CAGAGCCCTAAGAGGAAAAATGG - Intergenic
919888347 1:201951540-201951562 GAGAGCAGTGGGAGGAAAAAGGG + Intergenic
919986904 1:202681781-202681803 CTGAGCAGTCAGGGGATGGAAGG + Intronic
920284317 1:204868717-204868739 CAGAGCAGGCAGAGAACAGGAGG + Intronic
922165589 1:223113145-223113167 CTGTGGAGTCAGAGGAATGAAGG - Intronic
922227165 1:223655474-223655496 CATGGCAGGCAGGGGAAAGAGGG + Intronic
922494580 1:226046640-226046662 CAAAGCAGACAGAGGAAGGTGGG - Intergenic
923079736 1:230642175-230642197 CAGAGCAGTCTCAGGGTAGAAGG + Intergenic
923926930 1:238639851-238639873 CAAAGCAGTCGGAGCAAAAAGGG + Intergenic
1063977916 10:11431740-11431762 CTGAGCAGACAGAGGCATGATGG + Intergenic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064219784 10:13430971-13430993 CAGAGCTGTTAGAGGAACCAAGG + Intergenic
1066204559 10:33175257-33175279 CAGTGCAGTCAGTGGAGAAAGGG - Intergenic
1067667957 10:48294598-48294620 CTGAGCTGTCACAGGACAGAGGG + Intergenic
1067740592 10:48893057-48893079 TAGAGCAGTCAGAGGAAGCATGG - Intronic
1067799028 10:49345015-49345037 TAGAGCAGTCAGACAAGAGAAGG + Intergenic
1069800427 10:71078398-71078420 CAGGCCAGTGAGAGGACAGATGG + Intergenic
1069878580 10:71578010-71578032 CAGAGGGGTGAGAGGAGAGAGGG - Intronic
1070453045 10:76581156-76581178 CTGAGCAGCCTGAGCAAAGAAGG - Intergenic
1070546452 10:77456630-77456652 CAGAGCTGGCACTGGAAAGAGGG - Intronic
1071249374 10:83801384-83801406 CAGAGCAGCCAGAATAAAGTAGG - Intergenic
1071805613 10:89117219-89117241 CAGAGAAGTGAGATGAAAGGAGG + Intergenic
1071834408 10:89405717-89405739 CAAAAGAGTCAGAGGAGAGAAGG - Intronic
1072520731 10:96227649-96227671 CAGAGCAGTGACAGGAGACAAGG + Intronic
1072543954 10:96419891-96419913 CCTAGCAGTCACAGCAAAGAGGG - Intronic
1072826931 10:98616266-98616288 CAGAACTGACAGAGGAAAGGTGG - Intronic
1073004466 10:100312106-100312128 GAGAGTAGGCAGAGGAAAGTAGG + Intronic
1073500519 10:103932720-103932742 CAGAGAATTCAGAGGAAATCTGG - Intergenic
1073783854 10:106866610-106866632 CAGAGCACTGAGAGGGAACAAGG + Intronic
1074628585 10:115222550-115222572 CAAAGCAGATAGAGGAAAAAGGG + Intronic
1074872925 10:117591310-117591332 CAGAGAAGACAAGGGAAAGAAGG - Intergenic
1075090677 10:119442528-119442550 CAGAGCAGACTGAGGAAAGGTGG - Intronic
1075485662 10:122820195-122820217 CAGAGCATGCAAAGGAAAGGAGG - Intergenic
1076307205 10:129473881-129473903 CAGTGGGGCCAGAGGAAAGATGG + Intronic
1076840864 10:133044563-133044585 CAGGGCGGTCAGTGGAAGGACGG + Intergenic
1077212905 11:1381794-1381816 CAGAGCAGCGGGAGGAAAGCAGG - Intergenic
1077274982 11:1700572-1700594 CCTAGCAGTCAGAGCAAAAAGGG + Intergenic
1077336302 11:2006349-2006371 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1077452664 11:2659021-2659043 CATAGCAGTGAAAGGAAAGGAGG - Intronic
1077913717 11:6597118-6597140 CAGAGCTGGGAGAGGAAAAAGGG - Exonic
1078040416 11:7856506-7856528 CAGATCAGTGAGGGAAAAGATGG + Intergenic
1078466792 11:11555947-11555969 TAGAGGACTCAGAGGAAATAAGG - Intronic
1078727512 11:13944849-13944871 CAGAAGAGTTAGAGGGAAGAAGG + Intergenic
1079736034 11:23998531-23998553 CAGAGCAATCAGGCCAAAGAAGG + Intergenic
1079824161 11:25169524-25169546 CAGAGCAATCAGACAAGAGAAGG - Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080328049 11:31101178-31101200 CAGAGCAGTCCAAAGAAAGTAGG - Intronic
1080695480 11:34600007-34600029 CAGGGCAGGCAGAAGAGAGAGGG + Intergenic
1081090343 11:38857153-38857175 TAGAGAAGTTAGAGGATAGAAGG - Intergenic
1081247182 11:40782129-40782151 AAAAGCTGACAGAGGAAAGAGGG - Intronic
1081740276 11:45434706-45434728 CAGAGCAATCAGGGGTGAGATGG + Intergenic
1082615830 11:55357663-55357685 CAGAGCACTGAGAGGAAGCATGG + Intergenic
1082637625 11:55615644-55615666 CTGAGCAGTCACAGGCAACATGG + Intergenic
1083150044 11:60786279-60786301 CTGAGCAGGCAGAGGAAACGTGG - Intronic
1083344295 11:61978763-61978785 CAGAGAAGCATGAGGAAAGAAGG - Intergenic
1083683329 11:64361288-64361310 CAGAGCAGGAAGAGGCAGGAAGG - Intronic
1083691748 11:64413498-64413520 CTGAGCAACCAGAGGAAGGATGG + Intergenic
1083966770 11:66048371-66048393 CAGAGGAGACAGAGGAGAAAGGG - Intronic
1086075403 11:82845810-82845832 CAGAACAGTCAAATGACAGAGGG + Intronic
1086572173 11:88297677-88297699 CAGAGCAATCACAGGAACAAGGG + Intronic
1087574160 11:99969627-99969649 CAGAGCGGTCAGAATAATGAAGG - Intronic
1087636214 11:100704516-100704538 TAGAGCAGTCTGAGGAATGAAGG - Intronic
1087669317 11:101086582-101086604 CAGAGCAGTCAGGCAAGAGAAGG + Intronic
1088539657 11:110900693-110900715 CAAAGTAGACAGAGGAAAGAAGG - Intergenic
1088541764 11:110920717-110920739 CAGGGCAGTGAGAGCAAAGGAGG - Intergenic
1088750079 11:112835920-112835942 CAGATCACTCAGAGTGAAGATGG + Intergenic
1090130521 11:124136788-124136810 CAAAGATGGCAGAGGAAAGAAGG - Intronic
1090399928 11:126442693-126442715 CAGAGCAGGCAGAGGGAGGGGGG - Intronic
1091234125 11:134008381-134008403 CAGAGCAGGGAGAGGAGAGGTGG - Intergenic
1202819286 11_KI270721v1_random:61531-61553 CAGAGCAGTGAGATGGAAGGAGG + Intergenic
1091485330 12:881169-881191 CAGAACAGCCAGTGGAAACAAGG - Intronic
1092191037 12:6521057-6521079 CAGAGGAGTCAGAGGAGACCAGG + Exonic
1092334078 12:7613064-7613086 CAGAGCAGTCAGGCAAGAGAAGG + Intergenic
1092795646 12:12107998-12108020 AACAGCTGTCAGTGGAAAGAGGG + Intronic
1093690119 12:22101213-22101235 CAGAGCATTGAGAGGGAACATGG - Intronic
1094367638 12:29701054-29701076 CAGAGCAGTGAGAGGACAGAGGG - Intronic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1094502402 12:31033119-31033141 CAGAGGAGTGGGAGGAAGGAGGG - Intergenic
1094502496 12:31033709-31033731 CAGAGCAGTTTGGGGAATGAAGG + Intergenic
1094763896 12:33569327-33569349 CAGAGCAGTCAGAAAAGAGAAGG + Intergenic
1095226138 12:39679154-39679176 CAGAGCAATCAGACAAGAGAAGG + Intronic
1095257000 12:40050516-40050538 CAGAGCACTCATTGGACAGAAGG - Intronic
1095344712 12:41136470-41136492 AAGAGAAGGGAGAGGAAAGAGGG + Intergenic
1095400838 12:41813592-41813614 CAGGGGAGTGGGAGGAAAGATGG + Intergenic
1095969884 12:47894419-47894441 CAGCCCAGTCAGAGGAAATGGGG - Intronic
1096012160 12:48228118-48228140 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1096536705 12:52279497-52279519 CAGAGAAGTCCCTGGAAAGAAGG - Intronic
1096542841 12:52317804-52317826 CAGAGCCCTCTGAGGAAAGCCGG - Intronic
1096546651 12:52344753-52344775 CGGAGCAGTCAGAGCTAGGACGG + Intergenic
1096867179 12:54571567-54571589 CAAGGCAGTTAGAGGAAGGAGGG + Intronic
1097740545 12:63236831-63236853 CATAGCAGTCAAAGTAAACATGG + Intergenic
1099321707 12:81158894-81158916 TAGTACAGTTAGAGGAAAGAAGG - Intronic
1099476836 12:83118163-83118185 CAGAGCAATCAGACAAGAGAAGG - Intronic
1099740221 12:86625155-86625177 GAGAGCAGAGAGAGCAAAGAGGG - Intronic
1100848655 12:98686219-98686241 GAAAGCAGTCAGAGGAAAAAGGG - Intronic
1102628935 12:114259582-114259604 CAGAGCTCTCAGAGGAAATAAGG + Intergenic
1102647451 12:114413104-114413126 CTGAGCAGTCAGGAGAAAGATGG - Intergenic
1102838185 12:116087690-116087712 CAGACCAGTAAGAGGAAGGAAGG - Intronic
1103014478 12:117483024-117483046 CTGGGGAGTCAGAGGGAAGAAGG + Intronic
1103865560 12:124049287-124049309 CAAAGCATGCAGAGGAATGAGGG - Intronic
1104068160 12:125322503-125322525 CAGAGCTGTGAGTGGGAAGAGGG + Intronic
1104311188 12:127655504-127655526 CAGAGCAGCTAGAGTAAAGCAGG + Intergenic
1104628158 12:130376936-130376958 CACAGCAGGCAGAGGAAACCAGG - Intergenic
1105072035 12:133240257-133240279 CAGGGCAGTCACACCAAAGAAGG - Intergenic
1106060442 13:26285639-26285661 CAGAGCAGTCAGACAAGAGAAGG + Intronic
1106433904 13:29707499-29707521 CAGAGGAGACAAAGCAAAGAAGG - Intergenic
1106551172 13:30772356-30772378 GAGAGGAGTCAGGGGAAAGGAGG + Intergenic
1106810321 13:33352627-33352649 AAGAGAAGCCAGATGAAAGACGG + Intergenic
1107340222 13:39397581-39397603 CTGAGATGCCAGAGGAAAGAGGG - Intronic
1107567399 13:41619463-41619485 CAGTGCAGTCAGACAAGAGAAGG - Intronic
1107657180 13:42603625-42603647 CAGAGAAGCCAGAGGACAGTGGG - Intronic
1108081361 13:46740067-46740089 CAAAGCAGTCATAAGACAGAAGG - Intronic
1108209533 13:48124405-48124427 CAGAGGAATCAGAAGAAAGGTGG - Intergenic
1109155808 13:58907128-58907150 CAGAGCAGAGACAGGAAATACGG - Intergenic
1109679895 13:65737163-65737185 CAGAGCAATCAGACAAAAGAGGG + Intergenic
1109854793 13:68112334-68112356 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
1110148126 13:72219133-72219155 CAGAGCAATCAGCCAAAAGAAGG - Intergenic
1110534477 13:76635296-76635318 GATAGCAGTAAGAGGGAAGATGG + Intergenic
1110838206 13:80109596-80109618 CAGGGCAGTGACAGGAAATAAGG + Intergenic
1110917325 13:81038300-81038322 TAGAGCAGTCAGACGAAAGAAGG + Intergenic
1111097262 13:83533053-83533075 CGGAGCAGTGTGAGGAAAGCCGG + Intergenic
1111224272 13:85249036-85249058 CAGAGAGATCAGAGGAAAGGAGG + Intergenic
1112169539 13:96956326-96956348 CAGAGCAGGAGGAAGAAAGAAGG + Intergenic
1112230521 13:97585014-97585036 AAAATCAGGCAGAGGAAAGAAGG + Intergenic
1113070329 13:106414150-106414172 CAGAGAAGTCAGAGAAGTGACGG - Intergenic
1114278799 14:21170733-21170755 CAGAGCATTGAGAGGGAACATGG + Intergenic
1114898039 14:27017469-27017491 AAGAGCAGACAGAGGCAATATGG - Intergenic
1115177091 14:30575517-30575539 CAGAGCAGTCAGGCAAGAGAAGG + Intronic
1116088576 14:40274478-40274500 CAGAGCAATCAGACAAGAGAAGG - Intergenic
1116209567 14:41917439-41917461 CAGAGAAGACAGAGAAAAGGGGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1116335838 14:43655277-43655299 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1116741405 14:48759767-48759789 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1117125321 14:52617057-52617079 CATAGCAGCCAGAGGAAAGAAGG - Intronic
1117271694 14:54150695-54150717 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1117757099 14:58986771-58986793 CAGAACAGGCCGTGGAAAGATGG - Intergenic
1117951717 14:61089586-61089608 CAGTGCAGGCCCAGGAAAGAGGG - Intergenic
1118139827 14:63068360-63068382 CAGAGCAATCAGACAAGAGAAGG - Intronic
1119227507 14:72955509-72955531 CAGAGGAGCCTGTGGAAAGAGGG - Exonic
1119436790 14:74602799-74602821 CAGAGCAGTCCAAGGGGAGACGG + Intronic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1119949849 14:78733530-78733552 CAGAGTGGTCAGAGGTAACAAGG + Intronic
1120770038 14:88369693-88369715 GAGAGCAAGCAGAAGAAAGATGG + Intergenic
1121618860 14:95332360-95332382 CTGAGCCAGCAGAGGAAAGAGGG + Intergenic
1121780048 14:96616427-96616449 CAGAGCAGGGAGAGGCAAGGAGG + Intergenic
1122136428 14:99635468-99635490 CAGAGCATCCACAGGAAAGTGGG + Intergenic
1122409705 14:101519636-101519658 CAGACCCGTAAGAGGAAGGAGGG + Intergenic
1202900096 14_GL000194v1_random:30660-30682 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1123716158 15:23034162-23034184 CAGAGCCTTCAAAGGAAAGCAGG - Intronic
1123797662 15:23789019-23789041 CAAAGGAGTAACAGGAAAGAAGG - Intergenic
1124177013 15:27435879-27435901 TAGAGCAGCCAGAGGCAAGTTGG - Intronic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125368926 15:38949148-38949170 CAGAACAATTAGAGGAAAGGGGG - Intergenic
1125386361 15:39141243-39141265 CAGAACACTGAGGGGAAAGATGG + Intergenic
1125492678 15:40159963-40159985 CTGATGATTCAGAGGAAAGAAGG + Intergenic
1125838352 15:42774009-42774031 CAAAGCAGTCCCAGGAAAGAGGG + Intronic
1126117090 15:45217961-45217983 CAAAACAGCCAGAGGAAAAAAGG - Intergenic
1126222715 15:46232854-46232876 CGTAACAGTCAGAGGAAAGGTGG - Intergenic
1126670096 15:51108346-51108368 CAGAGAAGCCAAAGCAAAGAGGG - Intergenic
1126745025 15:51817625-51817647 CAGGGCAGTCGGAGGAGAGCCGG - Intergenic
1126803737 15:52324258-52324280 CAGTACAGTCAGGGGAAAGCTGG + Intronic
1126989264 15:54353725-54353747 CAGTGAGGTCAGAGGAAAGCTGG - Intronic
1126993057 15:54406017-54406039 CTGAGGACTCAGAGGATAGAAGG - Intronic
1127194811 15:56572531-56572553 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1128084451 15:64876194-64876216 CAGAGCAGTAAGAGGGAAGGAGG - Intronic
1128518526 15:68359977-68359999 CTGAGCAGACAGAGGAAGGTGGG + Intronic
1128701938 15:69811103-69811125 CAGAGGAGGCAGGGGAAGGAAGG - Intergenic
1129360114 15:75019329-75019351 CAGAGGGGCCAGAGGCAAGAGGG - Exonic
1129639873 15:77364517-77364539 CAGAGCAGTCAGACTCAAGGTGG + Intronic
1130090883 15:80820245-80820267 CAGACTGGTCAGAGGAAAGTGGG + Intronic
1130090980 15:80821188-80821210 CAGACAACTCAGAGGAATGAGGG + Intronic
1130272604 15:82459851-82459873 CAGTGCAGTCAGAGCACAAAGGG - Intergenic
1130487732 15:84407600-84407622 CAGTGCAGTCAGAGCACAAAGGG + Intergenic
1130587246 15:85191818-85191840 CAGTGCAGTCAGAGCACAAAGGG - Intergenic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1130953544 15:88611030-88611052 CAGAGCAGGAAGAGGAAAAGGGG - Intergenic
1131308118 15:91263850-91263872 GAGAGAAGGCAGAGGAAAGGAGG - Intronic
1131432779 15:92400135-92400157 CAGAGCAGTGAGAGAAAGGAAGG - Intronic
1133005588 16:2879827-2879849 GGGATCAGTCAGAGGAAAGTGGG - Intergenic
1133200619 16:4202132-4202154 CACAGCTGTCAGAGGGAAGGAGG + Intronic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133870028 16:9677452-9677474 CAGAGCAGGAGGAGGACAGAGGG + Intergenic
1133911570 16:10070843-10070865 AAAAGCAGACAAAGGAAAGAGGG - Intronic
1135170873 16:20182240-20182262 CAGAGGAGCCAAAGAAAAGAAGG + Intergenic
1135739278 16:24959619-24959641 CAGAGGTGGCAGAGGCAAGAAGG + Intronic
1135964041 16:27021306-27021328 CACAGCAGTGAGAGGAAGGATGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136735638 16:32464182-32464204 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1138626393 16:58255327-58255349 CAGAGCAGCTAGAGCAAAGCAGG - Intronic
1139041499 16:63004460-63004482 CAGAGCAGGGAGAGGAAGGGGGG - Intergenic
1139240746 16:65389445-65389467 CAGGACAGAAAGAGGAAAGAAGG - Intergenic
1139976323 16:70814004-70814026 CAGAGCAGTGGGGGAAAAGATGG + Intronic
1141877069 16:86833165-86833187 CAGACCAGTCAGAGGTCATATGG + Intergenic
1142192615 16:88724936-88724958 CAGGCCAGGCAGAGGACAGATGG + Intronic
1203017439 16_KI270728v1_random:365388-365410 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1203035774 16_KI270728v1_random:638546-638568 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1143040862 17:4035508-4035530 CAGAGGAGTCAGAGCACAGGTGG + Intronic
1143608693 17:8005204-8005226 CAGGGCAGTGACAGTAAAGATGG - Intronic
1145246340 17:21272310-21272332 GAGAGCAGCCAGAGGCAAGCAGG + Intergenic
1145901464 17:28493194-28493216 CAGAGAAGGCAGAGGAGGGAAGG + Intronic
1146126073 17:30232625-30232647 CAGAGGGGCCAAAGGAAAGATGG + Intronic
1146147966 17:30438519-30438541 GAGGGCAGTCAGAGCACAGAGGG + Intronic
1146156623 17:30529834-30529856 AATAGGAGTCAGAGGAAAGGAGG + Intergenic
1146621323 17:34400766-34400788 GGGAGCAGTCAGAGGAAACTTGG - Intergenic
1147551939 17:41449325-41449347 CTGAGCAGTCAGAGGAGATGTGG - Intergenic
1147955734 17:44133298-44133320 CAGAGGAGTCAGGGGAAGGAGGG - Intergenic
1148133148 17:45274324-45274346 CAGGGCAGGCAGTGGAAAGCAGG + Intronic
1148446396 17:47740384-47740406 AACAGCTTTCAGAGGAAAGATGG + Intronic
1148552717 17:48560112-48560134 CAGAGAAGGCAGAGGAAGGGAGG + Intronic
1148912844 17:50952297-50952319 CACAGGGGTCAGAGGAAGGAGGG + Intergenic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150956777 17:69868382-69868404 CAGAGCAGGAAAAGGAGAGAGGG + Intergenic
1151519512 17:74618076-74618098 CCATGCATTCAGAGGAAAGAGGG + Intronic
1151746366 17:76013932-76013954 CATGGCAGTCAGGGGAAAGGAGG - Intronic
1151881882 17:76900681-76900703 CAGAGCTGCCAGAGGAGAAATGG + Intronic
1152447580 17:80354923-80354945 CAGAGCAGGCAGGGGACAGGCGG + Intronic
1153165246 18:2254190-2254212 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1153310162 18:3669627-3669649 CGGGGCAGTCAGAGGAGAGCCGG + Intronic
1153367594 18:4275270-4275292 GAGAGCACTCAGTGAAAAGATGG - Intronic
1153547600 18:6224660-6224682 CACACCAGTCAGAGGAATGGAGG + Intronic
1154206604 18:12342728-12342750 CAGAGTATTCACAGGAAAAATGG - Intronic
1154487140 18:14881079-14881101 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1154498791 18:14983319-14983341 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1154502718 18:15004629-15004651 CAAAGCAGTCAGAGGCCACAGGG + Intergenic
1155235620 18:23816257-23816279 CAGATGTGGCAGAGGAAAGAAGG + Intronic
1156588432 18:38459072-38459094 GGGAGCAGGCAGAGGAAAAACGG - Intergenic
1157388136 18:47277503-47277525 TAGAGCAGACAGAAGAAACAAGG - Intergenic
1158187849 18:54791888-54791910 CAGGGCAGTCGGAGGAGAGTAGG + Intronic
1158305735 18:56103382-56103404 GAGAGAGGTCAGAGGAAGGAGGG + Intergenic
1158334678 18:56402902-56402924 CAGAGCCTTCAGAGGGAACATGG + Intergenic
1159728173 18:71989979-71990001 CATATAAGTCAGTGGAAAGACGG + Intergenic
1159755283 18:72356481-72356503 AAAAGCAGTGTGAGGAAAGATGG + Intergenic
1160111260 18:76033987-76034009 TAGAGCACACAGAGGGAAGACGG + Intergenic
1160131167 18:76226101-76226123 CCTAGCAGTCAGAGGAACGCAGG + Intergenic
1160147352 18:76375990-76376012 GAGACCAGGCAGAGGATAGATGG + Intronic
1160245885 18:77159060-77159082 CAGAGCCTTCAGAGGGAAGGCGG + Intergenic
1160368838 18:78353612-78353634 AAAAGGAATCAGAGGAAAGATGG - Intergenic
1160758595 19:771537-771559 CAGAGGAGGGAGAGGAGAGAGGG - Intergenic
1161672494 19:5622131-5622153 CAGAGCATTTACAGGAAAGGGGG - Intronic
1161946679 19:7441650-7441672 CAGACCAATCACAGGAGAGATGG + Exonic
1162385913 19:10360613-10360635 CAGAGTAGTCAGAGGGATGTGGG + Intronic
1162945619 19:14041666-14041688 CCGAGCAGACAGAGAAAAGGTGG - Intronic
1163617079 19:18335710-18335732 CTGGGCAGTCAGAGGAGAGCTGG + Intergenic
1164752293 19:30665857-30665879 CAGAGGACTGAGAGGAAAGGAGG + Intronic
1165108266 19:33487009-33487031 CAGAGCAGTGAGAGGCAACTGGG + Intronic
1166328289 19:42064597-42064619 CAGATCAGTAAGAGGAAGAATGG - Intronic
1166541407 19:43608133-43608155 CAGTGGTATCAGAGGAAAGAGGG + Intronic
1166748633 19:45154027-45154049 TAGAGCCGGCAGAGGAGAGATGG + Intronic
1167212823 19:48144114-48144136 CAGGAGAGTCAGAGGAAAGTGGG + Intronic
1167490458 19:49790024-49790046 CACAGCAGTCACAGGAAACCAGG - Intronic
1167935185 19:52900043-52900065 ATGGGCAGTAAGAGGAAAGATGG + Intergenic
1202647386 1_KI270706v1_random:155009-155031 CAGAGCAATCAGAAAAAAGAAGG + Intergenic
925474706 2:4200172-4200194 TAGAGCAGGCAGAGGACAGCAGG + Intergenic
925574063 2:5341845-5341867 CAATGCAGCCAGAGGAAGGAGGG - Intergenic
925964204 2:9048154-9048176 CACAGCAGTCAGAGGAGGGCTGG + Intergenic
926231352 2:11006428-11006450 CACAGCAGCCACAGAAAAGAGGG + Intergenic
926526102 2:13982852-13982874 CAGAGCAGTCTCAGGAGAGATGG - Intergenic
926566147 2:14476615-14476637 GAGAGCAGACAGAGGAAGAAAGG - Intergenic
926628604 2:15117125-15117147 CATACCTGGCAGAGGAAAGAGGG + Intergenic
926915657 2:17889421-17889443 CAGAGCAATCAGACAAGAGAAGG - Intronic
927337358 2:21940705-21940727 CTGAGCAGTGAGTGGAAGGAGGG - Intergenic
927390886 2:22594050-22594072 TAGAGAAGTCAGAGATAAGACGG + Intergenic
927438836 2:23094781-23094803 CAGATAAGAGAGAGGAAAGAAGG + Intergenic
927770118 2:25853319-25853341 CAGAGCCTTTGGAGGAAAGAGGG + Intronic
928462080 2:31484720-31484742 CAGAGCATTGAGAGGAAACATGG - Intergenic
928578345 2:32679342-32679364 CAGAGAATTCAGAGGGAATATGG + Intronic
928798799 2:35060467-35060489 CAGAGCAGTCAGGCAAGAGAGGG + Intergenic
929009939 2:37431386-37431408 CAGAGCAATCAGACAAGAGAAGG - Intergenic
929539773 2:42810704-42810726 CAGAGCAGTTAGAAACAAGAAGG - Intergenic
929885746 2:45876301-45876323 CAGAGAAGCCAGATGACAGAGGG - Intronic
929943107 2:46349711-46349733 GAGAGAAGTCAGAGAAAAGCGGG - Intronic
930356991 2:50333590-50333612 TAGAACAGACACAGGAAAGATGG - Intronic
931531045 2:63214620-63214642 CAGGGCAGTCAGGCAAAAGAAGG + Intronic
932168228 2:69528128-69528150 GAGAACAGTCTGAGCAAAGAAGG + Intronic
932995171 2:76843195-76843217 CAGAGAAGAGAGAGGAAACAAGG + Intronic
933398821 2:81765599-81765621 CAGAGCAGTCTGAGGAGAGCTGG + Intergenic
933748253 2:85585962-85585984 CAAAGCAGTGATGGGAAAGATGG + Intronic
933973210 2:87486876-87486898 CAGAGCAAGCAGAGAAAAGGTGG - Intergenic
934036195 2:88090599-88090621 CTGAGTAGGCAGAGGAAACAGGG + Intronic
934148584 2:89121123-89121145 CAGAGCAATCAGGCAAAAGAAGG + Intergenic
934177418 2:89587795-89587817 CAGAACAATCAGACAAAAGAAGG - Intergenic
934218710 2:90060919-90060941 CAGAGCAATCAGGCAAAAGAAGG - Intergenic
934287717 2:91662097-91662119 CAGAACAATCAGACAAAAGAAGG - Intergenic
935113853 2:100117032-100117054 AAAAGCAGACAGAGGAAAAAGGG - Intronic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
935834745 2:107037809-107037831 CAGAGCATTGAGAGGAAACATGG + Intergenic
936050969 2:109223326-109223348 CAGAGCCGACAGAGCCAAGAGGG + Intronic
936066613 2:109337358-109337380 CAGAGAAGTTACAGGACAGATGG - Intronic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936146104 2:109981523-109981545 CACGGCAGTCAGGGGAAAGCAGG - Intergenic
936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG + Intergenic
936320511 2:111463337-111463359 CAGAGCAAGCAGAGAAAAGGTGG + Intergenic
936505657 2:113103734-113103756 TACAGCAATCAGAAGAAAGATGG + Intergenic
937216982 2:120319003-120319025 CTGAGAAGTCCGAGCAAAGATGG + Intergenic
937810390 2:126193297-126193319 CAGTGCTGTCAAAGCAAAGATGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938497750 2:131811440-131811462 CAGAGCAATCAGACAAAAGAAGG + Intergenic
938969814 2:136421793-136421815 CAGGGAAGTCAGAGGGAAAAAGG - Intergenic
938996749 2:136687332-136687354 CAGAGCAATCAGACAAGAGAAGG + Intergenic
939783352 2:146476964-146476986 AAAAGCAGCCAGAGGAAGGAAGG + Intergenic
940709057 2:157140326-157140348 CAGAGCAATCAGACTACAGAAGG - Intergenic
941344231 2:164348098-164348120 CAGAGCACTGAGAAGAAACATGG - Intergenic
941399511 2:165013472-165013494 TATTGCAGTCAGAGGAAAAAAGG - Intergenic
941452914 2:165680826-165680848 CAGAGGAGGCTGAGGAAACATGG + Exonic
942032453 2:171976573-171976595 CATAACAAGCAGAGGAAAGATGG + Intronic
942218968 2:173750602-173750624 CAGGGCATAGAGAGGAAAGAGGG + Intergenic
942345784 2:175001507-175001529 CAGAAGGGTCTGAGGAAAGATGG + Intronic
943654626 2:190494997-190495019 CAGAGCAGTCAGACAAGAGAAGG + Intronic
943756616 2:191563728-191563750 CAGAGTATTAAGAGGAAAGGTGG + Intergenic
944619386 2:201498447-201498469 CAAAGCAGACAGAGGAAGGAGGG - Intronic
945203775 2:207310509-207310531 CAGAGCAGCCAGAGCCAAGCAGG + Intergenic
945226341 2:207534646-207534668 GAAAGCAGTCAAAGGAAAAAGGG + Intronic
945253566 2:207785049-207785071 CAGAGTAGGCTGAGGAATGATGG - Intergenic
945346839 2:208728398-208728420 CAGAGCAATCAGACAAGAGAAGG - Intronic
945657468 2:212643077-212643099 CAGAGCAGTCAGATCAGAGAAGG - Intergenic
945673154 2:212826278-212826300 TAGAGATTTCAGAGGAAAGATGG + Intergenic
945690292 2:213025748-213025770 AAGGGCAGTCAGAACAAAGAGGG - Intronic
945971513 2:216235752-216235774 AAGAGCAGGCAGAGTAAACAGGG + Intergenic
946112489 2:217432089-217432111 AAAAGCAGTAAGAGGAAAAATGG - Intronic
946633873 2:221702783-221702805 CAGAGAACTCAGAGCAAACAAGG - Intergenic
946718797 2:222582230-222582252 CAGAGAAGTCAAAAGAAAGGAGG + Intronic
946727183 2:222671990-222672012 CAGAGCAGGCAGGTCAAAGAGGG + Intronic
947043209 2:225948418-225948440 GAGAGCAGTCCCAGAAAAGATGG + Intergenic
947134333 2:226962040-226962062 CAGACCAATCAGAGAAGAGATGG + Intronic
947460868 2:230303904-230303926 CAGAGCAATCAGACAAGAGAAGG + Intronic
947576956 2:231283151-231283173 CAGAGCAGGGAGAAAAAAGACGG + Intronic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
947899326 2:233707206-233707228 CACAAAAGTCAGAGAAAAGATGG - Intronic
948002858 2:234582430-234582452 CAGAGGAGGCAAAGGAAAGAGGG - Intergenic
948763751 2:240208967-240208989 CTGAGCAGCCCGAGGAGAGAGGG + Intergenic
1169263012 20:4151225-4151247 CAGTGGAGTCAGAGCACAGAGGG - Intronic
1169307823 20:4508424-4508446 CAGACCAGTTAGGGTAAAGATGG - Intergenic
1169689253 20:8311978-8312000 TTGAGCAGTGAGAGGGAAGAGGG - Intronic
1170124082 20:12943190-12943212 CAGAGCACTCAGACAAGAGAAGG + Intergenic
1170950690 20:20933364-20933386 CAGAGCCGTGATAGGAAAGGCGG + Intergenic
1171487132 20:25493434-25493456 CAGAGCCGTCAGGAGAAAGGAGG + Intronic
1171893789 20:30742220-30742242 CAAAGCAGTCAGAGGAAGGTGGG - Intergenic
1173027723 20:39325039-39325061 CAGAGGTCTCAGAGGAAGGAAGG + Intergenic
1173378064 20:42507776-42507798 AACAGCAGCCAGAGGACAGAAGG + Intronic
1173659871 20:44725569-44725591 CAGAGCCGGGAGAGGAAAGGTGG + Intronic
1174191352 20:48742879-48742901 CAGAGAAGCCAAAGGAATGAGGG + Intronic
1174303152 20:49596382-49596404 CAGATGAGTCACAGGAAAGCTGG + Intergenic
1175171378 20:57083884-57083906 CAGAGCAGCCAGAGTGAGGATGG - Intergenic
1176604479 21:8817764-8817786 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1176619469 21:9045438-9045460 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1176794142 21:13358234-13358256 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1177579161 21:22996839-22996861 CAGAGAAGTCAGACAAGAGAAGG + Intergenic
1178251118 21:31004269-31004291 CAAAGCAGGCAGAGGAATGTCGG - Intergenic
1178426567 21:32483507-32483529 CCAGGCAGTCAGGGGAAAGATGG + Intronic
1179225346 21:39447971-39447993 AAGAGCCTTCAGAGGAAACATGG - Intronic
1179353433 21:40635160-40635182 CAGACAAGGCAGAAGAAAGAAGG + Intronic
1179442132 21:41402583-41402605 CAGACCAGTGAGGGGTAAGAAGG + Intronic
1180346770 22:11709372-11709394 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1180354522 22:11827488-11827510 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1180383733 22:12164871-12164893 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1180536918 22:16401747-16401769 CAGAGCAATCAGAAAAAAGAAGG + Intergenic
1180882483 22:19215864-19215886 CAGAGCAGTAAGAGGAGCGCAGG + Intronic
1181117209 22:20639653-20639675 CAGAGAAGGGACAGGAAAGAAGG + Intergenic
1182474551 22:30569565-30569587 AAGAGCAGTAGGAGCAAAGAGGG + Intronic
1182767318 22:32766988-32767010 AAGAACTGTCAGGGGAAAGAAGG - Intronic
1182877802 22:33707537-33707559 CAGAGCAGTTGGAGAAAGGAGGG - Intronic
1182943584 22:34301210-34301232 GAGAGAACTCAGAGGGAAGAAGG + Intergenic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1185052855 22:48562890-48562912 CGGGGCTGTGAGAGGAAAGAGGG - Intronic
1185063134 22:48617418-48617440 CAGAGCAGCAAGAGGATAAATGG + Intronic
1185236575 22:49716886-49716908 CAGACCAGACACAGGAACGAGGG + Intergenic
949541738 3:5037911-5037933 CAGAGAAGTCAAAAAAAAGAAGG + Intergenic
949980378 3:9499024-9499046 CAGATCAGGCAGAGAAAAGCGGG + Exonic
950109913 3:10412361-10412383 CACAGCAGACAGTGGACAGAGGG - Intronic
950841358 3:15970977-15970999 CAGAGCAATCAGACAAGAGAAGG + Intergenic
950878617 3:16302466-16302488 CAGAGCATTCAGACTACAGAGGG - Intronic
951283482 3:20780453-20780475 CAGAGAACTGAGAGGAAACACGG + Intergenic
951761377 3:26150913-26150935 CAGATCAATCAGATGATAGAAGG + Intergenic
951852291 3:27154945-27154967 CAGAGCAGTCAGGCAAGAGAAGG + Intronic
952081230 3:29759816-29759838 CAAAGCAGTCCCAGCAAAGATGG - Intronic
952329655 3:32352518-32352540 TTGAGAAATCAGAGGAAAGAAGG + Intronic
953006171 3:38981412-38981434 CAGAGCACTGTGAGGAGAGAAGG + Intergenic
953758866 3:45671215-45671237 CTGAGCATTCAGAGGAAAGCTGG + Intronic
955007883 3:54986765-54986787 CAGAGCACCCAGAGTAGAGATGG + Intronic
955825207 3:62938827-62938849 CAGATCCCTCAGAGGAAATATGG - Intergenic
956402416 3:68894790-68894812 CAGAACAGTAAAAGTAAAGATGG + Intronic
956859291 3:73306612-73306634 CAGAGAAGACAGAGGACAGTGGG + Intergenic
956996328 3:74830134-74830156 ATGAGCAGTAAGAAGAAAGATGG - Intergenic
957983415 3:87541939-87541961 CAGAGTAGTCTGAGGAATGTGGG + Intergenic
958444554 3:94199222-94199244 CAGAGCAATCAGACAAGAGAAGG - Intergenic
958466719 3:94469320-94469342 CACAGCAGGCTGAGGAAACAAGG - Intergenic
958632302 3:96699952-96699974 CAGGGCACTCAGAGGAGAGCTGG + Intergenic
958657525 3:97021383-97021405 CAGAGTAGTCACAGGAAGTAAGG - Intronic
958765093 3:98358299-98358321 AAGAGCAGTCAGCAAAAAGAGGG - Intergenic
959462839 3:106648464-106648486 CAAAGGAGACAGAGGAAAAAGGG - Intergenic
959512243 3:107226807-107226829 CAGAGGAGACACAGGAAGGAAGG + Intergenic
959649486 3:108737794-108737816 AAGAGCATTAAGAGGCAAGATGG + Intergenic
960415786 3:117383351-117383373 CAGGGCAGTCAGAGAAGAGTCGG + Intergenic
960551725 3:118983445-118983467 TAGAGCTGTCATATGAAAGAAGG + Intronic
960700403 3:120433885-120433907 CAGAGCAGCAAGAGGTAAGCTGG + Intronic
960742474 3:120850468-120850490 CAGAGAACTCAGCGGAAATAAGG - Intergenic
961150171 3:124631266-124631288 CAGAGTTGTCAGAGGAGAGATGG - Intronic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962993629 3:140603219-140603241 CAGAGTACTGTGAGGAAAGAGGG - Intergenic
963570295 3:146986341-146986363 AAGAGCAGAGAGAGGAAAGGTGG - Intergenic
963741551 3:149086600-149086622 CAAACCAGTCAGAGCACAGAAGG + Intergenic
965196573 3:165604985-165605007 CAGAGCAGTCAGGCAAGAGAAGG - Intergenic
965321010 3:167251114-167251136 CAGAGCAGTTGGAGGAGAGCTGG + Intronic
965772285 3:172193340-172193362 GAAAGCAGTTAGAGGAAGGAAGG - Intronic
967121152 3:186383927-186383949 CAGAGCAGTGGGAGAGAAGAGGG + Intergenic
967236435 3:187388875-187388897 CAGAGCAATCAGACAAGAGAAGG + Intergenic
967512002 3:190322884-190322906 GAGAGCAGAGAGAGGAAAGAAGG - Intronic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
967676481 3:192305058-192305080 CAGAGAAGGGAGAGGAAGGAGGG + Intronic
968019445 3:195371548-195371570 CAGAGCAGTCAGACAAGAGAAGG - Intronic
968040775 3:195587526-195587548 CACAGGAGGGAGAGGAAAGAGGG - Intergenic
968331320 3:197872958-197872980 CTGGGCAGTGAGAGGGAAGATGG + Intronic
968515945 4:1015682-1015704 CTGAGCAGTGACAGGAAAGAGGG + Intronic
968552620 4:1231453-1231475 CAGAGCAGGCTGGGGAAAGCTGG + Intronic
969542277 4:7800292-7800314 CTGGGCAGTGAGAGAAAAGAGGG + Intronic
969559092 4:7934607-7934629 CAGAGGAGAGAGAGGAAAGCAGG + Intronic
970196653 4:13557630-13557652 CAAAGCAGTGAGATGGAAGATGG + Intergenic
970233035 4:13930385-13930407 TAGAGCAGGCAGAGGACAGAGGG - Intergenic
970476513 4:16429247-16429269 CAGAGAAGTCAGATAAAACAAGG - Intergenic
970676936 4:18461926-18461948 CAGAGCAGAGAGAAGAAAAATGG + Intergenic
971013027 4:22459988-22460010 CAGAGCAGAAAGTAGAAAGAGGG - Intronic
971500584 4:27314023-27314045 CAGAGCAATCAGAGAAGGGATGG + Intergenic
971891775 4:32533252-32533274 TAGACCAATCAGATGAAAGAAGG + Intergenic
971995450 4:33958069-33958091 CAGAGCATTGAGAGGGAACAAGG - Intergenic
972313938 4:37908049-37908071 TACATCAGTCAAAGGAAAGAGGG + Intronic
972783430 4:42305816-42305838 CAGAGGTGTCACATGAAAGAAGG + Intergenic
972854429 4:43089924-43089946 CAGAAAATTCAGAGGAAACATGG - Intergenic
973373646 4:49273176-49273198 CAGAGCAATCAGACAAAAGAAGG + Intergenic
973387371 4:49522036-49522058 CAGAGCAATCAGACAAAAGAAGG - Intergenic
973757048 4:54085518-54085540 CAGAGCAGTCAGATGAGGAAGGG + Intronic
973959875 4:56099300-56099322 TAAAGGAGTCAGAGGAAACAGGG - Intergenic
974281414 4:59799514-59799536 CAGAGCAACCAGACAAAAGAAGG - Intergenic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
975405119 4:73980372-73980394 CAGAAAGGTCAGAGGAGAGAGGG + Intergenic
975631190 4:76404117-76404139 CATGGCAGTCAAGGGAAAGAAGG + Intronic
975917804 4:79346005-79346027 TAGAGCAATCAGACAAAAGAAGG - Intergenic
976824171 4:89240942-89240964 CAAAGCAGTTGCAGGAAAGAAGG - Exonic
976956587 4:90909018-90909040 TAGAGCCCTCAGAGGAAATATGG - Intronic
977342888 4:95782264-95782286 CAGAGGAGTGAGAAGAAAGATGG - Intergenic
977662233 4:99603231-99603253 CAGTGGAGACACAGGAAAGATGG + Intronic
977803540 4:101268318-101268340 GAGAGAAGTCTGAGAAAAGAAGG + Intronic
977834081 4:101628698-101628720 CAGAGCAATCAGATAACAGAAGG - Intronic
977886048 4:102252669-102252691 CACAGCAGAAAGTGGAAAGATGG - Intronic
978006148 4:103619512-103619534 CAGAGCAGTCAGGCAAAAGAAGG - Intronic
978208320 4:106105510-106105532 CAGAGCACTGAGAGGGAACATGG + Intronic
978661597 4:111133611-111133633 CAGAGCAATCAGACAAAAGAAGG - Intergenic
979145826 4:117246575-117246597 CAGAGGAGGCAGAGGGAACAGGG + Intergenic
979860095 4:125682874-125682896 CAGGGCAGTCGGAGGAGAGCCGG - Intergenic
980263165 4:130480806-130480828 CAGATCAGTCAGATTAAAGTGGG + Intergenic
980877259 4:138674243-138674265 TAGAGCAGTCACAAGCAAGAAGG + Intergenic
981132178 4:141169235-141169257 CAGAGCAGGAAGAAGAAAAAAGG - Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981302225 4:143200530-143200552 CAGAGCAGTCAGGCAAGAGAAGG + Intronic
981847583 4:149187205-149187227 CAGAGCCTTCAGAGAAAACATGG - Intergenic
982219240 4:153110838-153110860 AGGAGCAGCCAGAGGAATGATGG + Intergenic
982297583 4:153845430-153845452 CACAGCAGTGGGAGGGAAGAAGG + Intergenic
982548225 4:156761091-156761113 AAGAGCAGTCTGAAGACAGAAGG + Exonic
982868603 4:160548864-160548886 CAGAGCAGTAATAAGAAAGCTGG - Intergenic
983060184 4:163151493-163151515 CAAATCAGTGAGAGAAAAGATGG - Intronic
983702145 4:170610507-170610529 GACAGCAGACAGTGGAAAGAGGG + Intergenic
984690025 4:182716015-182716037 AAGAGGAGTCAGAGGCAACAAGG - Intronic
985203009 4:187504252-187504274 CAGAGCTGTGAAAGTAAAGATGG - Intergenic
985356076 4:189120809-189120831 CAGAGCAATCAGACAAGAGAAGG + Intergenic
986849203 5:11791148-11791170 CAGAGATGTCAGAGGGAACATGG + Intronic
987380693 5:17283123-17283145 GAGTGCAGTCAGTGGAAGGAAGG - Intergenic
987404123 5:17507611-17507633 CAAAGCAGGCAATGGAAAGAAGG - Intergenic
987411733 5:17621317-17621339 CAAAGCAGGCAATGGAAAGAAGG - Intergenic
987715172 5:21559203-21559225 AAAAGAAGACAGAGGAAAGAAGG + Intergenic
987954676 5:24723090-24723112 CAGAGTAGTCATAGGGAAGAAGG - Intergenic
988059076 5:26143111-26143133 GAGAGAAGAAAGAGGAAAGAGGG + Intergenic
989347608 5:40447253-40447275 GAGAGCAGTCATTGGAAAGTGGG - Intergenic
989470944 5:41817826-41817848 CAGAGAAGTCAGAGGAAACTAGG + Intronic
989948961 5:50274340-50274362 TAGGGCATTCAGAGGCAAGAAGG + Intergenic
990738717 5:58890936-58890958 AAGAACAGGCAGAGGAAAGCAGG - Intergenic
991438525 5:66621409-66621431 CAGAGCATGCAGAGAAAACAGGG + Intronic
993030021 5:82695032-82695054 AACTGCAGTCAGAGGAAAGAGGG - Intergenic
993595550 5:89850307-89850329 CAGAGCAGTCACATGACAGATGG + Intergenic
993634261 5:90325659-90325681 CAGAGCACTAAGAGGGAACATGG - Intergenic
994094074 5:95832955-95832977 CAAAGCAGTGAGAGGGAACAGGG + Intergenic
994897363 5:105722581-105722603 CAGAGCAGTGAGAGAGAACATGG + Intergenic
995292407 5:110472047-110472069 CAGAACAGTTAGACTAAAGAAGG + Intronic
995441329 5:112195620-112195642 AAGGACAGTCAGAGGGAAGAAGG - Intronic
995649538 5:114354419-114354441 CAAATCATTCAGAGGGAAGAAGG - Intergenic
996495454 5:124149693-124149715 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
996512154 5:124328712-124328734 CAGAGCAGTCACAGGAGAATAGG - Intergenic
996523123 5:124449240-124449262 CTGAGCACCCAGGGGAAAGAAGG - Intergenic
997025898 5:130060560-130060582 CAGAGCAGTCAGGCAAGAGAAGG + Intronic
997076723 5:130687393-130687415 GAGACCACTCACAGGAAAGAGGG + Intergenic
997108637 5:131049470-131049492 CAGAGACTTCAGAGGAAACATGG + Intergenic
997181875 5:131837851-131837873 CAGAGCAATCAGGTGAGAGAAGG - Intronic
997223406 5:132189668-132189690 CAGAGCAGATAGAGAAAAAATGG + Intergenic
997600338 5:135134509-135134531 GAGAGCTGACAGAGGAGAGATGG - Intronic
998397023 5:141825273-141825295 CAATGCAGTCAGAGGGAAGGGGG + Intergenic
999138203 5:149337966-149337988 CAGAGCAGCTGGAGCAAAGAGGG + Intronic
999230081 5:150056587-150056609 CAGACCAGTCAGAGGACAAAGGG - Intronic
999350735 5:150868977-150868999 CAGAGCAATCAGAAAAGAGAAGG - Intronic
999640462 5:153667273-153667295 CACACCAGTCAGAAGGAAGAAGG - Intronic
999930475 5:156427530-156427552 CAGAGCAATCAGACAAGAGAAGG - Intronic
999991041 5:157050083-157050105 CAGACCAGTGAGAGGCAATAAGG - Intronic
1000645799 5:163758852-163758874 AAGAGGAGGCAGAGAAAAGAGGG - Intergenic
1000698713 5:164421776-164421798 CAGAGCACTGAGAGGGAACATGG - Intergenic
1001176829 5:169477315-169477337 CAGAGCAATCAGACAAGAGAAGG - Intergenic
1001934226 5:175693235-175693257 CAGAGCATTCAGAGGGTGGAAGG + Intergenic
1003064374 6:2890775-2890797 CCAAGCAGTCAGAGGCAGGAAGG + Intronic
1003216989 6:4122800-4122822 CAGAGTAGCCCGATGAAAGAAGG - Intronic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003451629 6:6239860-6239882 CAGAGCAGGAGGAGGAAAAAGGG + Intronic
1003680612 6:8250061-8250083 AAGAGCTGTGAGAGGATAGAGGG + Intergenic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1004542343 6:16562959-16562981 CAGAGAAGTCAGGGTAGAGAGGG + Intronic
1006045263 6:31290111-31290133 AAGAGCACTCATAGGTAAGAAGG + Intronic
1006722764 6:36169354-36169376 GAGAGGAAGCAGAGGAAAGATGG - Intergenic
1007708538 6:43806411-43806433 GAGAGGAGTCAGAGGGAGGAAGG + Intergenic
1007777994 6:44234447-44234469 CAGTGAAGACAAAGGAAAGATGG - Intergenic
1008108036 6:47461416-47461438 CTGAGCAGTCAGATGAAATGAGG - Intergenic
1008211537 6:48730048-48730070 CAGAGCATTGAGAGGAAACGTGG + Intergenic
1008231831 6:48992279-48992301 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1008323400 6:50146662-50146684 CTAAGCAGTCAGAGAAAAAAGGG + Intergenic
1008373256 6:50760829-50760851 CAGAGCCGTGAGAGGAAGTAAGG + Intronic
1008537803 6:52520440-52520462 CAGAGCAATCGGAGAAGAGATGG + Intronic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009495228 6:64338127-64338149 CAGAGCAGTCAGACAAGAGAAGG + Intronic
1009799924 6:68524137-68524159 CAGAGCAATCAGACAAGAGAAGG - Intergenic
1009860103 6:69317704-69317726 CAGAAGATTCTGAGGAAAGAAGG - Intronic
1010466239 6:76169791-76169813 CAGAGCAGTCAGAGAAGACAAGG + Intergenic
1010647611 6:78410664-78410686 CAGAGCAATCAGACAAGAGAAGG + Intergenic
1011092714 6:83624540-83624562 CAGAGAAGAAAGAGGAAAGAAGG - Intronic
1011194286 6:84766066-84766088 CAGAGAAGTCAGAGATAAAAGGG - Intergenic
1011206764 6:84907242-84907264 TTGAGCAGTGAGAGAAAAGAAGG + Intergenic
1011309190 6:85963254-85963276 CAGAGCAATCAGACAAGAGAAGG - Intergenic
1011623091 6:89260903-89260925 GAGAGCAGACAGAGGTGAGAAGG - Intronic
1011804662 6:91058776-91058798 GAAAGCAGCCAGAGAAAAGAAGG - Intergenic
1011823238 6:91276735-91276757 CAGAGAAGAAAGAGTAAAGAGGG - Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012868222 6:104643128-104643150 CACAGAACTCAGAGGAAAGATGG + Intergenic
1012974310 6:105763588-105763610 GGGAACAGTCAGAGGAAAGGAGG - Intergenic
1013161010 6:107544862-107544884 CAGAGCAGGCAGAGGCCAGCAGG - Intronic
1013505260 6:110793843-110793865 CTGAACAGACAGAGGAAAGGAGG + Intronic
1013561438 6:111309363-111309385 CAGGGCAGTCAGAGAAGAGACGG - Intronic
1013629147 6:111968310-111968332 CCTAGCAGCCAAAGGAAAGATGG + Intergenic
1014361562 6:120482972-120482994 CAGAGCAGTAACAGTAAAGCAGG - Intergenic
1014390927 6:120863003-120863025 TAGAGCAGTCAGACAAGAGAAGG + Intergenic
1014504979 6:122243939-122243961 CAAAGCAGCAAGAGAAAAGAAGG + Intergenic
1014717960 6:124887750-124887772 CAGGGCAGTCAGAGGAGAGCTGG + Intergenic
1015530038 6:134212481-134212503 GAGAGCAGTGAAAGGGAAGAGGG - Intronic
1015546969 6:134371245-134371267 TAGAGCCGTCAGAGGAAGCATGG - Intergenic
1015771563 6:136773400-136773422 CAGAGCAGTTTCAGGAAAGCAGG - Intronic
1016642221 6:146362063-146362085 GAGAGCAGAGAGAGGAGAGAGGG - Intronic
1016708474 6:147141875-147141897 CAGAGCATGCAGAGGAAAGATGG - Intergenic
1016832453 6:148447485-148447507 CCCTGCAGTCAGAGGAAAGAGGG - Intronic
1016997266 6:149969529-149969551 AAGAGGAGTCAGGGGGAAGAAGG - Intronic
1017339309 6:153302176-153302198 CAGGGCAGTGGGAGGAAAGTTGG - Intergenic
1018707758 6:166475437-166475459 CAGAGTAGTGGGAGGAAGGAAGG - Intronic
1019287339 7:230273-230295 CAGAGCTGGGAGAGGCAAGAAGG + Intronic
1019468110 7:1201634-1201656 CGGGGCAGTCAGAGGAGAGCTGG + Intergenic
1019726658 7:2606577-2606599 CAGAGCAGTCTGTGATAAGAGGG - Intronic
1020400360 7:7769926-7769948 CAGCACAGTGAGAGGAAAGTTGG - Intronic
1020681893 7:11246823-11246845 CTGACCAGGAAGAGGAAAGAAGG + Intergenic
1020995777 7:15262130-15262152 CAGAGCAATCAGACAAGAGAAGG + Intronic
1021734178 7:23627046-23627068 CAGAGCAGTCAGTGTGAAGCTGG - Intronic
1021779571 7:24089685-24089707 CAGAGCAATCAGATAAGAGAAGG - Intergenic
1022031016 7:26491912-26491934 CAGAACACGCAAAGGAAAGAGGG - Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022713600 7:32876405-32876427 GAGAGCAGTCAGATCACAGAGGG + Intronic
1022844489 7:34196395-34196417 AAGAGCAGTAAGAGCAAAGTGGG + Intergenic
1023305309 7:38819680-38819702 CAGAGAAGCCAGGGGAGAGAGGG - Intronic
1023774153 7:43587466-43587488 CAGAGCAGTCAGGGGTAATAGGG + Intronic
1023985550 7:45092506-45092528 CTGAGCAGTCAGTGGAAGGGAGG - Intergenic
1024105248 7:46077673-46077695 AAAGGCAGCCAGAGGAAAGAAGG + Intergenic
1024268141 7:47622151-47622173 TGGAGCAGTCAGAGGAGAGCTGG - Intergenic
1027328634 7:77067693-77067715 CAGAGCAGTCAGACAAGAGAAGG - Intergenic
1028499355 7:91501586-91501608 CAGAGCAATCAGACAAGAGAAGG - Intergenic
1028738876 7:94249478-94249500 CTGAGCAGCCTGAGGAGAGAAGG + Intergenic
1028796669 7:94910270-94910292 CAGAGCAGGGGGAGGAAATATGG + Exonic
1029787131 7:102803679-102803701 CAGAGCAGTCAGACAAGAGAAGG + Intronic
1029924257 7:104298837-104298859 CAGATTACTCAGAGCAAAGATGG + Intergenic
1029991122 7:104963419-104963441 AAGAGGAGACAGAGGAAAGCAGG - Intergenic
1030255289 7:107503984-107504006 CAGAGCAATCAGGGAAGAGAAGG - Intronic
1031023683 7:116656338-116656360 CAAAGCAGTAGGATGAAAGAAGG + Intergenic
1031843616 7:126777226-126777248 CAGAGAAGTGAAAGGGAAGAGGG + Intronic
1032429285 7:131847855-131847877 TGGAGTAGTCAGAGGAAAGAGGG + Intergenic
1032626375 7:133595886-133595908 CAGAGAAGACAGAGGCAAGGTGG - Intronic
1032882342 7:136103062-136103084 CAGAGCAGTTAAAGGGAAGGAGG + Intergenic
1033204009 7:139400742-139400764 CAAAGCAGTGAGAGAAAAGATGG - Intronic
1033719262 7:144039859-144039881 TAGAGCAATCAGACAAAAGAAGG + Intergenic
1034229053 7:149505888-149505910 AAGATGAGTCAGATGAAAGAAGG + Intergenic
1034364273 7:150533247-150533269 CAGAGCATTGAGAGGGAACATGG - Intergenic
1034770517 7:153770294-153770316 CACAGCAGTCAGAGGAGAAGGGG + Intergenic
1034974815 7:155441903-155441925 CTGAGCAGTCAGTGGTGAGATGG - Intergenic
1035343478 7:158180933-158180955 CAGAGCAGTCAGAAAACAGAAGG - Intronic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035770679 8:2144482-2144504 CAGAGCAGGCAGAGGACAGCAGG - Intronic
1036205473 8:6802580-6802602 TAGAGCATTTAGAGAAAAGAAGG - Intergenic
1036610683 8:10347284-10347306 CAGACCAGGGAGTGGAAAGAGGG - Intronic
1036778497 8:11629752-11629774 CAGAGAAGACAGAGGCGAGAAGG + Intergenic
1036807342 8:11844693-11844715 CACAGAAATCAGAGGAGAGACGG - Exonic
1037408737 8:18571355-18571377 AAGAGCCATCAGAGGAACGAAGG - Intronic
1037410650 8:18592418-18592440 AAGAGCAGAAAGAAGAAAGAGGG + Intronic
1037521782 8:19686794-19686816 CAGGGCAGTCAGAGGATGGATGG - Intronic
1037590552 8:20308391-20308413 CAGAGAAGACAGAGGAGAGATGG - Intergenic
1038173082 8:25156442-25156464 TAGAGGAGTCAGAGGGAAAATGG + Intergenic
1038233490 8:25728662-25728684 CAGAGCACTGAGAGGGAACATGG - Intergenic
1038235517 8:25749681-25749703 CAGAACAGCCAGAGGAAAAAAGG + Intergenic
1038364354 8:26915921-26915943 CTGAGCTGTCAGAGGAGTGAGGG + Intergenic
1038417188 8:27405596-27405618 CAGAGCACACACAGGAAACAGGG - Intronic
1040355736 8:46616999-46617021 CAGAGGAGTGAGAGGAAAGGAGG + Intergenic
1040535507 8:48305630-48305652 CAGAGCAGTCACATGAGAGCTGG - Intergenic
1040728329 8:50410842-50410864 TAATGCAGCCAGAGGAAAGAAGG - Intronic
1042150153 8:65773083-65773105 CAGAGGAGTCAGTGGAAGAAGGG + Intronic
1042188548 8:66162011-66162033 CAGAGCAATCAGATAAGAGAAGG - Intronic
1042431734 8:68714285-68714307 CAGAGCAGTCTGACAAGAGACGG + Intronic
1042525576 8:69761454-69761476 CAGTGTAATCAAAGGAAAGACGG - Intronic
1043280992 8:78465966-78465988 CAGAGCACTGAGAGGGAACATGG + Intergenic
1043727423 8:83628884-83628906 CAGAGCATTCAGAGGGAGCAGGG - Intergenic
1043849707 8:85202288-85202310 CAGAGCACTGAGAAGAAAAAAGG - Intronic
1045504408 8:102768445-102768467 CAGTGAAGTCAGGGGACAGAAGG + Intergenic
1045549784 8:103161218-103161240 CAAAGGAATCAGAGGAAAGGGGG - Intronic
1046255618 8:111693622-111693644 CAGAGCACTGAGAGGAAGCATGG - Intergenic
1046514560 8:115241522-115241544 CAGGTCAGACAGAGGAAATAAGG + Intergenic
1046673851 8:117087452-117087474 CAGAACAGAAAAAGGAAAGATGG - Intronic
1046712705 8:117529467-117529489 CAGAGAAGTCAGGGAAAATAAGG + Intronic
1047970650 8:130081431-130081453 CAGAGCAGTCATAGGAAGAAAGG - Intronic
1048145156 8:131834474-131834496 TAGAGCCGTCAGAGGGAGGATGG + Intergenic
1048166479 8:132066116-132066138 CAGAGGAGAGATAGGAAAGAAGG + Intronic
1048398521 8:134039503-134039525 CAGAGCATTGAGAGGAAACATGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049086112 8:140479887-140479909 CAGAGCAGTCAGGAAAAAGTGGG + Intergenic
1049726971 8:144151449-144151471 CAGGGCAGTCGGAGGAGAGCTGG + Intronic
1050754501 9:8984588-8984610 CTGAGAAGTCAGAAGAAAAATGG - Intronic
1051214257 9:14779398-14779420 CAGAGAAGGAAGAAGAAAGAAGG + Intronic
1051929796 9:22371198-22371220 CAGAGCACTCAGACAAGAGAAGG + Intergenic
1051999934 9:23266150-23266172 CACAACAGTCAGAGGAATGCTGG - Intergenic
1052053785 9:23881404-23881426 CAGAGCAGTCAGACAAGAGAAGG - Intergenic
1052094540 9:24368934-24368956 CAGAGCACTGAGAGGGAACATGG - Intergenic
1052173012 9:25425516-25425538 CAGAGGCCCCAGAGGAAAGAAGG + Intergenic
1052715583 9:32112453-32112475 CAGAGCCTTCAGAAGAAACATGG + Intergenic
1053316740 9:37058599-37058621 CAGAGCAGTCTGAGTGAAGTGGG - Intergenic
1053753207 9:41276266-41276288 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1053884593 9:42634408-42634430 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1053888070 9:42659826-42659848 CAGGGCAATCAGACAAAAGAAGG - Intergenic
1054223615 9:62441853-62441875 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1054227090 9:62467276-62467298 CAGGGCAATCAGACAAAAGAAGG - Intergenic
1054258735 9:62840632-62840654 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1054333044 9:63779411-63779433 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1054351331 9:64019164-64019186 CAGAGTAATCAGACAAAAGAAGG - Intergenic
1054354842 9:64050471-64050493 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1054795944 9:69302143-69302165 CAGAGCAGTAGGAAGAAGGATGG - Intergenic
1055132799 9:72794375-72794397 CAGAGCATTGAGAGGGAACATGG + Intronic
1055500811 9:76900769-76900791 CTGAGCAGTGAGAAGAATGAGGG - Intronic
1055983785 9:82034788-82034810 CAGAACAGTCATAGCAAACATGG + Intergenic
1056031652 9:82559887-82559909 CAGATAAGGCAGAGGAAAGCTGG - Intergenic
1056308397 9:85314850-85314872 CAGAGAAGTCCTAGCAAAGAAGG + Intergenic
1056408387 9:86299062-86299084 CAGGTCAGCCAGAGGAAGGAGGG + Intronic
1056601368 9:88049781-88049803 GAGAGCAGAGAGAGGAAAAATGG + Intergenic
1056649595 9:88447002-88447024 AAGAGCAGAGAGAGGAATGAGGG - Intronic
1056665296 9:88576785-88576807 CAGAGAACCCAGAGGAAAGCAGG - Intronic
1056703333 9:88930246-88930268 CAAATCAGTCAGGAGAAAGAAGG + Intergenic
1057093949 9:92287604-92287626 CACAGAAGTCAGAAGAGAGATGG + Intronic
1057225078 9:93288914-93288936 CAGAGCAGTCACAGGAGGGGAGG - Exonic
1058440241 9:105000072-105000094 CAAAGCAGCTAGAGGACAGACGG - Intergenic
1058475377 9:105327671-105327693 CAGAGCAGGCAAAGGCAAAAAGG - Intronic
1058567137 9:106298054-106298076 CAGTGTAGTCAGAGAAAAGAGGG + Intergenic
1058600798 9:106667971-106667993 CCTAACAGTCAGAGCAAAGATGG + Intergenic
1058758135 9:108102790-108102812 CAGAGCAGAGACAGGAGAGAAGG + Intergenic
1059081150 9:111251714-111251736 AGGAGCAGTCAGAGCATAGAGGG + Intergenic
1059393838 9:114017983-114018005 CAGAGCAGTGAGGGGCAAGCAGG - Intronic
1059669049 9:116476215-116476237 CTGAGAAGACAGAGCAAAGAAGG - Intronic
1059686331 9:116640489-116640511 CAGTTCACTCAGTGGAAAGAAGG + Intronic
1059984139 9:119805545-119805567 TAGAGCAGACATAGGGAAGAAGG + Intergenic
1060187359 9:121571869-121571891 CAGGACAGTCAGAGGCAGGAAGG + Intronic
1060822088 9:126667213-126667235 CAGAGCAGTTAGAGGAAATATGG - Intronic
1061472688 9:130839634-130839656 CAGAGAGGTCAGAGGAAAACTGG - Intronic
1061828888 9:133277955-133277977 CGCATCAGCCAGAGGAAAGAAGG + Intergenic
1062278029 9:135739747-135739769 CAGAGCACTGTGTGGAAAGAAGG - Intronic
1062604746 9:137341655-137341677 CAGGGGAGTCAGAGGAAACGGGG + Intronic
1062604780 9:137341789-137341811 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604796 9:137341849-137341871 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604808 9:137341895-137341917 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604854 9:137342073-137342095 CAGGGGAGTCAGAGGAAACGGGG + Intronic
1062604909 9:137342295-137342317 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604921 9:137342341-137342363 CAGGGGAGTCAGAGGAAACAGGG + Intronic
1062604930 9:137342385-137342407 CCCAGGAGTCAGAGGAAACAGGG + Intronic
1202800038 9_KI270719v1_random:167722-167744 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1203697344 Un_GL000214v1:111180-111202 CAGAGCAATCAGACAAAAGAAGG + Intergenic
1203743179 Un_GL000218v1:19601-19623 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1203551863 Un_KI270743v1:169847-169869 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1185931370 X:4207023-4207045 CAGAGCAGGAGGAGGAAGGATGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186058856 X:5681690-5681712 GAGGGAAGTGAGAGGAAAGAAGG + Intergenic
1186553144 X:10528085-10528107 AAAAGCAGAAAGAGGAAAGATGG - Intronic
1186876711 X:13824912-13824934 TAGAGCATTCAGAGAAAACATGG - Intronic
1186958608 X:14710296-14710318 TTGAGCAGTAAGAGGGAAGAGGG + Intronic
1187138652 X:16572155-16572177 CAGAGCAGCTAGCGTAAAGAAGG + Intergenic
1187192981 X:17054416-17054438 CAAAACAGTCAGAGGAAGGGTGG - Intronic
1187323944 X:18269007-18269029 CATAGTAGTGAGTGGAAAGAGGG - Intronic
1188224058 X:27575128-27575150 TGGAGCAGTCAGAGGAGAGCCGG - Intergenic
1188388488 X:29591098-29591120 CAGAGCAGTGGGAGGGGAGATGG + Intronic
1188473748 X:30568428-30568450 CATTGCAGACAGAGGAGAGAAGG + Intronic
1188781968 X:34296268-34296290 GAAATCAGTCAGAGGAAAGGAGG + Intergenic
1188842952 X:35037972-35037994 CAGAGCATTGAGAGGGAACATGG + Intergenic
1188957530 X:36450819-36450841 TAGAGCAGTCAGACAAGAGAAGG + Intergenic
1189731421 X:44024942-44024964 GAAAGAAGTTAGAGGAAAGAGGG - Intergenic
1189833358 X:44997333-44997355 CAGCGCAGTCGGAGGAGAGCTGG - Intronic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190188099 X:48253550-48253572 TACAGCAGTCAGAGGGAATATGG + Intronic
1191697253 X:64003016-64003038 CAGAGCAGTCCAAGCAAAGGGGG + Intergenic
1191738831 X:64416386-64416408 CAGAGCATTCAGAAGGAACATGG - Intergenic
1192696549 X:73422236-73422258 CAGAGCATTGAGAAGAAACATGG - Intergenic
1192891986 X:75399727-75399749 CAGAGCACTGAGAGGAAATATGG + Intronic
1193006031 X:76618726-76618748 CAGAGCATTGAGAGGGAAAATGG + Intergenic
1193299138 X:79868109-79868131 CAGAGAATTGAGAGGAAACATGG + Intergenic
1193689707 X:84625927-84625949 CAGAGCAATCAGATAAGAGAAGG - Intergenic
1193887452 X:87000157-87000179 TAGAGCAGTCAGAAAAGAGATGG + Intergenic
1194137179 X:90160831-90160853 CAGAGCATTGAGAGGGAACATGG - Intergenic
1194436662 X:93875217-93875239 GATAGCCGTGAGAGGAAAGAAGG + Intergenic
1195293224 X:103449478-103449500 CAGAGCAATCAGACAAGAGAGGG - Intergenic
1195473422 X:105259315-105259337 CAGAGCATTGAGAGGGAACAGGG - Intronic
1196204390 X:112922794-112922816 CAGAGCAGGAGGAAGAAAGATGG + Intergenic
1196692225 X:118572024-118572046 CAGAGCAGTGAGAAGAGACAGGG + Intronic
1196846077 X:119897669-119897691 CAGAGCAGCCAGAGGCTAAAGGG - Intronic
1197556491 X:127961541-127961563 CAGAGAAATCAGAGAAGAGAAGG - Intergenic
1197611829 X:128647956-128647978 CAGAGCAATCAGAAAAGAGAAGG + Intergenic
1197950479 X:131890662-131890684 CAGAGGAGGAAGAGGAAAGATGG - Intergenic
1198538096 X:137606496-137606518 TAGAGCAATCAGACAAAAGAAGG + Intergenic
1199182348 X:144873251-144873273 CAGAGCACTGAGAGGAAGCATGG - Intergenic
1199304513 X:146251699-146251721 CAGTGCAGTTAGAAGAAAGCAGG + Intergenic
1199768261 X:150956404-150956426 CAGAGAAGGCAGAGTGAAGAGGG - Intergenic
1199856625 X:151764082-151764104 CAGAGCAGGCTAAGGAAAGGTGG + Intergenic
1200384245 X:155873899-155873921 CAAAGTAGGCAGAGGAAGGAAGG - Intergenic
1200482912 Y:3730755-3730777 CAGAGCATTGAGAGGGAACATGG - Intergenic
1201153136 Y:11105429-11105451 CAGAGCAATCAGACAAAAGAAGG - Intergenic
1201156708 Y:11137068-11137090 CAAAGCAGGCAGAGGAAGGTGGG + Intergenic
1201365140 Y:13196791-13196813 CAGAGCAGTCAGTCAAGAGAAGG + Intergenic
1201386508 Y:13445691-13445713 CAGACCAGTCAGGGGAGAGAAGG - Intronic
1201756085 Y:17486683-17486705 CAGAGCAATCAGAAAAAAGAAGG + Intergenic
1201845467 Y:18419302-18419324 CAGAGCAATCAGAAAAAAGAAGG - Intergenic