ID: 1003940418

View in Genome Browser
Species Human (GRCh38)
Location 6:11019647-11019669
Sequence GGCAAGGAGGATAGTGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 456
Summary {0: 2, 1: 1, 2: 3, 3: 28, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003940411_1003940418 15 Left 1003940411 6:11019609-11019631 CCACACATCAAACTGTTAACAGT 0: 2
1: 0
2: 1
3: 15
4: 145
Right 1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG 0: 2
1: 1
2: 3
3: 28
4: 422
1003940410_1003940418 22 Left 1003940410 6:11019602-11019624 CCAGAGACCACACATCAAACTGT 0: 2
1: 0
2: 1
3: 15
4: 194
Right 1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG 0: 2
1: 1
2: 3
3: 28
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003940418 Original CRISPR GGCAAGGAGGATAGTGGGCA TGG Intronic
900101017 1:962139-962161 GGCACTAAGGATTGTGGGCAGGG - Intronic
900318089 1:2069349-2069371 GGCAGGGAGGGTCCTGGGCAAGG + Intronic
900799426 1:4728201-4728223 GGAAATGAGGGTCGTGGGCAGGG + Intronic
901003699 1:6161435-6161457 AGCAGGGAGGCTGGTGGGCAGGG - Intronic
901801699 1:11711975-11711997 GGCATGGAAGATAGTGGGGTAGG - Intronic
902542116 1:17162950-17162972 AGGAAGGAGGAAACTGGGCAGGG + Intergenic
902542666 1:17165966-17165988 GGAAGGGAGGATGGTGGGGATGG - Intergenic
902604031 1:17558870-17558892 GGCAGGGAGAATGGTGGGGAGGG + Intronic
902685838 1:18077170-18077192 AGCAAGGAGGATGCTGGGGATGG + Intergenic
903276174 1:22223419-22223441 GGCAAGGAGGCTTCTGTGCATGG - Intergenic
903657753 1:24959447-24959469 GGCAAGCGCCATAGTGGGCACGG + Intronic
903996487 1:27308076-27308098 GGGAAGCAGGACAGGGGGCAGGG - Exonic
904316504 1:29669624-29669646 GGTCAGGAGGAGAGTGGGGAGGG - Intergenic
904586774 1:31585071-31585093 GGCAAGGAGCTCCGTGGGCATGG + Intronic
904599034 1:31663856-31663878 GGCAAGCAGCATAGCGGGGAAGG + Intronic
904842118 1:33379394-33379416 GGCAAGGGGGACAGTGGGCAGGG - Intronic
905986233 1:42285646-42285668 GCCATTGAGGATAGTGGACAAGG + Intronic
906109183 1:43312075-43312097 GGGAAGGAGGAGAGGGGGCCTGG + Exonic
906947233 1:50305372-50305394 GGCTAGGAGGAAAGGAGGCATGG + Intergenic
907736868 1:57121777-57121799 GGCTAGGAAGGTGGTGGGCAAGG + Intronic
908583071 1:65538315-65538337 GGCAAGGAGGAAGGTGGAGATGG - Intronic
909791272 1:79680788-79680810 AGCAAGGAGGTTCGTGGTCAGGG - Intergenic
911499162 1:98664032-98664054 GGCAAGGAAGGTAGTGGAAAGGG - Intronic
912470680 1:109904835-109904857 GGCCAGGAGGATGTGGGGCAGGG - Intergenic
912792806 1:112669399-112669421 TCAAAGGAGGGTAGTGGGCATGG + Intronic
914747850 1:150512587-150512609 GGAAAGGAAGAGAGTGGGGAAGG - Intronic
914917317 1:151826556-151826578 TGCAGGGAGGAGCGTGGGCATGG - Intronic
915310122 1:155002391-155002413 GGAAAGGAGGAGGGTGGGAAAGG + Intergenic
915605332 1:156946888-156946910 GGCAAGGAGGAGATTGGGGGAGG - Intronic
915724277 1:158006820-158006842 AGCATGTAGGAAAGTGGGCATGG + Intronic
916206373 1:162319660-162319682 GGCACTGAGGACAGTGGGGAGGG - Intronic
916949743 1:169767559-169767581 AGGAAGGAAGAAAGTGGGCAGGG + Intronic
917471987 1:175333887-175333909 GGAAAGGAGGACAGTTGGCTAGG + Intronic
919852246 1:201680814-201680836 AGAAAGGAGAATGGTGGGCAGGG + Intronic
919888878 1:201955589-201955611 GAGAAGGAGGGCAGTGGGCAGGG - Intronic
919924666 1:202186209-202186231 GGCAAGGGGGCAAGGGGGCAAGG - Intergenic
919924670 1:202186217-202186239 GGCAAGGGGGCAAGGGGGCAAGG - Intergenic
920808802 1:209262459-209262481 GACAATGTGGATAGTGGGAAGGG - Intergenic
921527040 1:216230113-216230135 TGCAAGGAGGACAGTGGGTTGGG + Intronic
921540309 1:216406043-216406065 GGGAAGGGAGACAGTGGGCATGG + Intronic
922031796 1:221808298-221808320 AGAAAGCAGGATGGTGGGCAGGG + Intergenic
922729571 1:227942646-227942668 GGCAGGGAGGAAAGGGGCCAGGG - Intronic
923492189 1:234493771-234493793 GGGAAGAAGGAGAGTGGGGAAGG + Intergenic
923685699 1:236151960-236151982 GATAAGGAGGGAAGTGGGCAGGG + Intronic
924142448 1:241039708-241039730 AGCATGGAGAATCGTGGGCAGGG - Intronic
924372259 1:243363378-243363400 GGCAATGAGGAAATCGGGCATGG + Intronic
924802661 1:247338776-247338798 GAGAAAGAGGATAGTGGTCAGGG + Intergenic
1063193329 10:3718069-3718091 GGGAAGGAGGGAAGTGGGGAGGG + Intergenic
1063892240 10:10642589-10642611 AGCAAGGAGGGAAGGGGGCAAGG - Intergenic
1065760905 10:28982689-28982711 GGTAAGGAAGAAATTGGGCATGG + Intergenic
1066228333 10:33406852-33406874 GGCAAGAAAGAGAGTGTGCAGGG - Intergenic
1066556586 10:36621155-36621177 AGGAAGGAGGATAGTAGGGAAGG - Intergenic
1067530263 10:47066063-47066085 GGCAAGGAGCAGGGTGGGGAAGG - Intergenic
1068331642 10:55578790-55578812 GGCAAAAAAGATAGTGTGCAGGG + Intronic
1069576468 10:69533514-69533536 GGGAAGGGGGAGAGTGGGCAAGG + Intergenic
1069786370 10:70990731-70990753 GGGAGGGAGGGTGGTGGGCATGG + Intergenic
1070459061 10:76646508-76646530 GGCTATGAGGAATGTGGGCAAGG - Intergenic
1071502204 10:86212078-86212100 GGGATGGAGAATAGTGGGCATGG - Intronic
1071588439 10:86847800-86847822 GGCAAGGAGGGTGGTGAGGAGGG - Intronic
1071678713 10:87682892-87682914 GGAAAGGAGGATAGAGAGCAAGG + Intronic
1072228991 10:93397803-93397825 GGCAGGGAGGCTGGCGGGCAGGG - Intronic
1072806399 10:98426208-98426230 GCCAAGCAGGGCAGTGGGCAGGG + Intronic
1073376810 10:103042271-103042293 GCCAGGGAGGATGGTGGGCCCGG - Intronic
1073513801 10:104059792-104059814 CCCAAGCAGGGTAGTGGGCAAGG - Intronic
1073656566 10:105423646-105423668 GCCAAGGAGCAAAGTGGCCATGG - Intergenic
1073739286 10:106387751-106387773 GGCAAGGAGGCTAGGGTACAGGG + Intergenic
1074720204 10:116257357-116257379 GGCAGGGAGGATAGAGGGGCAGG - Intronic
1074994230 10:118741965-118741987 GGCCAGGAGGATAGGGGGTGGGG - Intronic
1075700636 10:124467377-124467399 GGCAGGGTGGAGAGGGGGCAGGG + Intronic
1076790612 10:132775029-132775051 GGCAGGGAGGAGGGGGGGCAGGG + Intronic
1076790676 10:132775194-132775216 GGCAGGGAGGAGAGGGGGCAGGG + Intronic
1077284759 11:1760723-1760745 GCCAAGCAGGACAGAGGGCAAGG + Intronic
1077490872 11:2860381-2860403 GGCAAGGAGGGTTCTGGGGATGG - Intergenic
1078498190 11:11841695-11841717 GGCAGGGAGGACAGTGGGCCTGG + Intronic
1078870738 11:15342304-15342326 GGGAAGGCGGGAAGTGGGCAGGG - Intergenic
1080211651 11:29793600-29793622 GGCAAGGAGAGGAGTGGTCATGG - Intergenic
1080935309 11:36857099-36857121 GTCATGGAGGATAATGGACAAGG - Intergenic
1081654424 11:44848185-44848207 GGAAAGGAGGATGAGGGGCAGGG + Intronic
1083147767 11:60771693-60771715 TGCACGGAGGAGTGTGGGCAGGG + Intronic
1083225740 11:61283355-61283377 GGCAAGGAAGGAGGTGGGCAAGG - Intronic
1083722258 11:64609151-64609173 AGGAAGGAGGGGAGTGGGCAGGG + Intronic
1083935078 11:65865798-65865820 GGCCAGGAGGCTGGGGGGCAGGG - Exonic
1084268711 11:68017956-68017978 AGCAAGAAGCAGAGTGGGCAAGG - Intronic
1084902255 11:72318390-72318412 GGCAAGGAGGGGTGAGGGCAGGG + Intronic
1085300929 11:75457788-75457810 TGCCAGGAGGAGAGGGGGCAGGG + Intronic
1085560653 11:77470555-77470577 GGAAAGGAGAAAACTGGGCATGG + Intronic
1085738286 11:79058246-79058268 GTCAAGAAGGATAATGGGCCAGG + Intronic
1087389999 11:97519806-97519828 GACTAGGTGGCTAGTGGGCAAGG + Intergenic
1088663277 11:112069591-112069613 GCCAAGGTGGATAGTGGGAAAGG + Intronic
1088678340 11:112217969-112217991 GGCAAGGAGGAAGAGGGGCAGGG + Exonic
1088771968 11:113044125-113044147 GGCAAGGAGGATACTCTGCCTGG + Intronic
1089258114 11:117204662-117204684 GCCAAGGAGGACAGTGGACTTGG - Exonic
1089659672 11:119977772-119977794 GGGAAGGAGGTAAGGGGGCAGGG + Intergenic
1089895259 11:121924233-121924255 GACAAGGAGGAGAGTGGGGGAGG + Intergenic
1090805341 11:130198802-130198824 GGCAGGGAGGCCAGTGGGCGTGG + Intronic
1091358168 11:134954208-134954230 GGGAAGCAGGAAAGTGAGCAGGG - Intergenic
1091454683 12:598336-598358 GGCAAGGAGGAGGGTGGGGGCGG - Intronic
1091775286 12:3181013-3181035 GTCAAGGAGGAGACTGGACAGGG + Intronic
1092000810 12:5030445-5030467 GGTAAGGGGGAAAGTGAGCAAGG - Intergenic
1092171000 12:6374098-6374120 GGGAAGGAGAAGAGAGGGCAGGG + Intronic
1092171559 12:6376519-6376541 GGAAAGGAAGAGGGTGGGCATGG + Intronic
1093290434 12:17313570-17313592 GAAAAGGAGGAGAGTGGACAGGG + Intergenic
1093462683 12:19420714-19420736 TGTAAGCAGGATAGTGGACATGG - Intronic
1093837527 12:23853062-23853084 GAAAAGAAGGATAGTGGGGATGG + Intronic
1094350169 12:29515504-29515526 AGCAAGGAGGATTCTGGGCAGGG - Intronic
1096214597 12:49792270-49792292 TGCAAGGAGGGCAGTGGGGAGGG + Intronic
1096876301 12:54632952-54632974 GGCAAGGACAATAGGGAGCATGG - Intronic
1097369410 12:58758285-58758307 GGGAATGAGGGGAGTGGGCATGG + Intronic
1100200821 12:92296262-92296284 GACAAACAGGATAGGGGGCAGGG - Intergenic
1101437543 12:104677035-104677057 GGAAAGGAGGAAATGGGGCAGGG - Intronic
1101749107 12:107568415-107568437 GCCAAGTAGGGTAGTGGGAAGGG - Intronic
1102729142 12:115092624-115092646 GGCCAGGATGAAAGTGGGAAGGG - Intergenic
1103251621 12:119504977-119504999 GGGAAGGAGGAAGGTGGGGAGGG - Intronic
1103472760 12:121194990-121195012 TGAATGGAGCATAGTGGGCAAGG - Intergenic
1104351110 12:128044727-128044749 GGCAAGGAGGGAAGAGGACATGG - Intergenic
1104720340 12:131041831-131041853 GGAAAGGAGGACCGTGGGGAGGG - Intronic
1104836282 12:131793905-131793927 GGCTCGGGGGAGAGTGGGCACGG + Intronic
1105432045 13:20345322-20345344 GGCCAGGAGGAGAGTGGTCCAGG + Intergenic
1106181070 13:27369817-27369839 TGGAAGGAGGAAAGTGGGGAAGG - Intergenic
1106235923 13:27860398-27860420 GGAAAGGAGGATAGAGATCATGG + Intergenic
1106657132 13:31758362-31758384 GGCAAGGATGACTGTGGGAACGG + Exonic
1107006732 13:35620449-35620471 GGCAAGGAGGCCAGTGGGCCAGG + Intronic
1108688340 13:52840081-52840103 GGCAGTGAGGAAAGTGAGCAGGG + Intergenic
1109250120 13:60009482-60009504 GGAAAGGAAGAAAGTGGGAAGGG + Intronic
1110334205 13:74307800-74307822 GGCAAGGAGGAATGAAGGCATGG + Intergenic
1110343629 13:74420573-74420595 GTCAAGCAGGATAGTGGGAAAGG + Intergenic
1111745970 13:92270051-92270073 GGTAAGGAGGGTGGTGGGGAAGG + Intronic
1113608844 13:111629084-111629106 GGCACACAGGAAAGTGGGCAGGG + Intronic
1114368182 14:22053445-22053467 GGCTGGGAGGAGGGTGGGCAAGG - Intergenic
1114652874 14:24297493-24297515 GGCAAGGAGGGTAATAGGCGGGG - Intronic
1117346894 14:54841526-54841548 GGAAAGGAGGTTGTTGGGCATGG + Intergenic
1118028775 14:61799369-61799391 AGCAAAGGGGAAAGTGGGCAGGG - Intergenic
1119007897 14:70949737-70949759 GGTAAAGTGGAAAGTGGGCAAGG - Intronic
1119053076 14:71389853-71389875 GGCTCGGAGGAGAGTGGGAAAGG + Intronic
1119438851 14:74614696-74614718 GGCAAGGTGAGAAGTGGGCAGGG - Intergenic
1119776402 14:77251816-77251838 GGCAATGAGGAGGGTGGACAGGG - Exonic
1121160376 14:91733371-91733393 AGTCAGGAGGATAGGGGGCAAGG + Intronic
1121282519 14:92709578-92709600 GGCAGGGAGCATAGGAGGCAGGG + Intronic
1121648833 14:95540525-95540547 GGCACGGGGCAGAGTGGGCAAGG - Intronic
1122256903 14:100485060-100485082 GGCAAGGAGCCTAGTGGGGCTGG - Intronic
1122329716 14:100904222-100904244 GGCCAGGAGGGTGGTGGGAATGG - Intergenic
1124881108 15:33643551-33643573 GGCGAGGAGGAGAGTGGGCTAGG + Intronic
1125769348 15:42154538-42154560 GGGAAGGAGCAGAGTGGGGAGGG + Intronic
1126799975 15:52289564-52289586 GGCAAGGGGGCTGGTAGGCAGGG - Intronic
1127122952 15:55786869-55786891 GGCAGGCAGGATAGTGAGCTTGG + Intergenic
1128389460 15:67173352-67173374 GCCAAGGAGGAAAGTGTGGATGG + Intronic
1129208891 15:74054110-74054132 GGCGTGGAGGATAGTGGGGTGGG + Intergenic
1130398784 15:83529818-83529840 AGCAATGATGACAGTGGGCAGGG + Intronic
1130851444 15:87798229-87798251 GGGAAGAAGGAAGGTGGGCAGGG - Intergenic
1130908063 15:88253786-88253808 GTCTGGGAGGATAGTGAGCAGGG - Intronic
1132238515 15:100239743-100239765 GGCCAGGAGGAAGGTGGACATGG + Intronic
1134423574 16:14116954-14116976 GGGAAGGAGGGTACTTGGCAAGG + Intronic
1134556698 16:15171886-15171908 GGCAAGGAGGTTGGTGGGGCTGG - Intergenic
1134915910 16:18070828-18070850 GGCAAAGCGCATAGTGGTCAGGG - Intergenic
1134917279 16:18083599-18083621 GGCAAGGAGGTTGGTGGGGCTGG - Intergenic
1135223898 16:20638898-20638920 GACAAGGAGGAGGGTGGGCCAGG - Intronic
1136378517 16:29879593-29879615 GGCAGGCTGGAGAGTGGGCAGGG - Intronic
1137673657 16:50293231-50293253 GGCAGGGAGGATGGGGGCCAAGG + Intronic
1137679968 16:50332986-50333008 GGCAGGGAGGGAAGGGGGCAAGG + Intronic
1137864186 16:51876405-51876427 GGCAACGAGAAATGTGGGCATGG + Intergenic
1139506919 16:67403099-67403121 GGCAAAGAGGAAAGGGGGCCTGG + Intronic
1139968134 16:70756822-70756844 GGAAAGGATGGTAGGGGGCAAGG - Intronic
1140123676 16:72103780-72103802 GGCGAGGAGGTGAGTGGGCGTGG + Exonic
1140195223 16:72849511-72849533 GGCAGTGTGGAAAGTGGGCAGGG - Intronic
1140450963 16:75070458-75070480 GGAAAGCAGGATCGGGGGCAAGG - Intronic
1142488646 17:263156-263178 GACAAGGAGGGAGGTGGGCATGG + Intronic
1143498262 17:7324561-7324583 GGCAAGGTGGACTGTGGGCTCGG - Intronic
1143515326 17:7416883-7416905 GGAAAGGAGGAGTGAGGGCAAGG - Intronic
1143515875 17:7418954-7418976 GGCAAGCAGGATACAGGGCGAGG + Exonic
1145053256 17:19680687-19680709 ATCAAAGAGGATGGTGGGCAGGG + Intronic
1145241563 17:21243440-21243462 GGCAGAGAGGAGAGTGGTCAGGG + Intronic
1145880749 17:28351088-28351110 GGCAGCAAGGATAGGGGGCAGGG - Intronic
1146255929 17:31391629-31391651 GGGAAGGAGAAGAGTGGGGAGGG - Exonic
1146519470 17:33515139-33515161 GGCAAGGAGGGAAGTGCACAGGG + Intronic
1146700999 17:34960281-34960303 GGCAGGGAAGATATTGGGAAAGG - Intronic
1146931895 17:36783529-36783551 GGCAGGGAGGTAAGTGGGTATGG - Intergenic
1147198290 17:38782301-38782323 GGCAGGGAGGATGGTGCTCAGGG - Intronic
1147387248 17:40089784-40089806 GGGAAGGAGGAATGTGGGCTGGG + Intronic
1147418643 17:40311131-40311153 GACAAGGAGGCCACTGGGCAGGG - Intronic
1147440895 17:40446714-40446736 GGCAAGGAGGAAAGGGGGAGGGG - Intronic
1147853448 17:43460031-43460053 AGAAAGGAGGCTAGTGGGCGGGG - Intergenic
1148027792 17:44600388-44600410 AGCAAGGAGGGAGGTGGGCAGGG - Intergenic
1149145038 17:53480133-53480155 GGCAAGGAGGGTAGATGTCAAGG - Intergenic
1149549836 17:57532078-57532100 GGCAGGAAGGAGCGTGGGCAGGG + Intronic
1150042734 17:61880812-61880834 GGAAAGGAGGAAAGGGGGGAGGG + Intronic
1151345422 17:73498460-73498482 GGCAAGGAGGACAATCGGAAAGG - Intronic
1151758407 17:76087606-76087628 GGCAAGGAGGCGAGTGGGGCAGG + Intronic
1152014994 17:77744696-77744718 GGCCAGGACCATAGTGGGCAGGG - Intergenic
1152328814 17:79658540-79658562 GGCAGGCAGGATACTGGCCACGG - Intergenic
1152691979 17:81722457-81722479 GGAGAGGAGGCCAGTGGGCAGGG + Intergenic
1153912090 18:9713302-9713324 GGGAAGGGGGATGGTGGGGAGGG + Intronic
1153924430 18:9823260-9823282 GACGGGGAGGAAAGTGGGCATGG + Intronic
1154284019 18:13034858-13034880 GGCAAGGAGGAAGGCAGGCATGG - Intronic
1154948440 18:21184850-21184872 TGCAGGGAAGATAGTTGGCAGGG - Intergenic
1155456901 18:26026635-26026657 GGCAAGCAGGAGGGTGGGGAAGG + Intronic
1155546256 18:26919025-26919047 GGCAAGAGGGAGAGTGTGCAGGG + Intronic
1156060814 18:33074003-33074025 GGGAATGAGGCTAGTGGTCAAGG + Intronic
1156240842 18:35252414-35252436 GGTAAGGAGGGGTGTGGGCAGGG - Exonic
1157526416 18:48386040-48386062 GGAATGGAGGATAATGGGTAAGG - Intronic
1158345410 18:56511428-56511450 GGTAAAGAGGTGAGTGGGCAGGG - Intergenic
1158870182 18:61679120-61679142 GCTAAGAAGGATAGTGGGGATGG + Intergenic
1161505812 19:4642834-4642856 GCCATGGAGGGTGGTGGGCAGGG + Intronic
1161718398 19:5890205-5890227 GCCATGGAGGACTGTGGGCAGGG + Intronic
1161925642 19:7296887-7296909 GGCCCAGAGGAGAGTGGGCAAGG + Intergenic
1161981766 19:7633656-7633678 GGCATGGTGGGTAGGGGGCAGGG + Exonic
1162183255 19:8885325-8885347 GGGAGGGAGGAGAGTGGGAAAGG + Intronic
1162936548 19:13984265-13984287 GGCAAGGAGCAAAGAGGGCCAGG - Intronic
1162996487 19:14339142-14339164 GGGGAGGAGGAAAGTGGGGAGGG - Intergenic
1163207225 19:15812553-15812575 GGAAAGGAGGAGAGTGAGGAAGG + Intergenic
1164591584 19:29510583-29510605 GGCTGAGAGGAGAGTGGGCAAGG + Intergenic
1164853612 19:31503876-31503898 GGGGAGGAGGAAAGGGGGCAAGG + Intergenic
1166220075 19:41358536-41358558 GGTAATGAGCATAGTGAGCACGG + Intronic
1167792156 19:51689424-51689446 GGGAAGGAGGATGGCGGGGACGG + Intergenic
1167958950 19:53090663-53090685 GGCCTGCAGGATAGAGGGCAAGG + Intronic
925141109 2:1550402-1550424 GGCAGGGAGGAAAGTGTACAGGG + Intergenic
926274550 2:11393773-11393795 GACAAGGAGGAGAGTAGGGAAGG - Intergenic
927442362 2:23128214-23128236 GCCAAGGAGGATGGTAAGCAGGG - Intergenic
927947964 2:27148835-27148857 AGGCAGGAGGATAGTGGGGAAGG - Intergenic
928035047 2:27815143-27815165 GGCATTGAGGGCAGTGGGCATGG + Intronic
928494401 2:31817444-31817466 GGCAAGGAGGGAGGTGGGGATGG - Intergenic
928785873 2:34885482-34885504 GGAATGGAGGAAAGTGGGGATGG - Intergenic
928875765 2:36037139-36037161 GGGAAGGAAGAGAGAGGGCAAGG + Intergenic
928946366 2:36775433-36775455 GGCATGGGGGATGGTTGGCAAGG + Intronic
929367035 2:41171483-41171505 GCCAAGGAGGATAATGGAAAAGG + Intergenic
929533192 2:42764865-42764887 GGCAAGGAGTGGAGTGGACAAGG - Intergenic
929559159 2:42945100-42945122 GGGAGGGAGGGCAGTGGGCACGG + Intergenic
929610121 2:43264746-43264768 GGGCAAGAGGATAGAGGGCAGGG + Intronic
931957061 2:67439340-67439362 GGGAGGGAGGAGAGTAGGCATGG - Intergenic
932538099 2:72620574-72620596 GCCAAGGCGGATATTGAGCAAGG - Intronic
932885974 2:75549532-75549554 GGCTGGGAGGAGAGTGGGGAGGG + Intronic
933232092 2:79819631-79819653 GGCTAGAAGGGTAGTGGGGAGGG + Intronic
933576160 2:84070888-84070910 GGGAGGGAGGAAAGGGGGCATGG + Intergenic
936144594 2:109971634-109971656 GACATAGAGGATATTGGGCAGGG - Intergenic
936181278 2:110269597-110269619 GACATAGAGGATATTGGGCAGGG - Intergenic
936200093 2:110399835-110399857 GACATAGAGGATATTGGGCAGGG + Intergenic
936658393 2:114514674-114514696 GGCAAAGAGAAGAGTGGGAAAGG + Intronic
937419245 2:121740810-121740832 GGGAAGGAGGAGAGGGGGCCTGG - Intronic
937918541 2:127113671-127113693 GGAAAGCAGGACAATGGGCAGGG - Intergenic
938021452 2:127908953-127908975 GCCAAGGAGCACACTGGGCAGGG + Intergenic
939650765 2:144759212-144759234 GGCAAGAAAGGTAGTGGGTAGGG + Intergenic
940016435 2:149111079-149111101 GGCAAGGAGGCTAGTGTGTTGGG + Intronic
940450727 2:153833121-153833143 GGCAGGGAGCATAGTCAGCATGG - Intergenic
942259193 2:174140651-174140673 GGCAAAGGGGATTTTGGGCAGGG - Intronic
943230205 2:185241345-185241367 GGTTAGGAGGTAAGTGGGCAGGG + Intergenic
943311479 2:186330318-186330340 GGCAAGGAAGATATTATGCAAGG - Intergenic
946154741 2:217800050-217800072 GGCAGGGAGGGTGGTGGGAAGGG + Exonic
946162057 2:217841335-217841357 GGAAGGGAGGATATGGGGCAAGG + Intronic
946179541 2:217941372-217941394 GGCAAGGGGCAGAGTGGGCCAGG + Intronic
946428281 2:219611524-219611546 GGGAAGGAGCATCGTGAGCATGG + Intronic
947382607 2:229559840-229559862 GGGAAGGAGGAGAGTGGAAATGG - Intronic
947546222 2:231012123-231012145 GGCAAGAAGGAAAGTGTCCAAGG + Intronic
948425715 2:237885672-237885694 GGCAGGGAGGTCAGTAGGCAGGG - Intronic
948912560 2:241011776-241011798 TGGAAGGGGGCTAGTGGGCAAGG - Intronic
1170035111 20:11981637-11981659 GGAAAGGAGGATGGAGGGAAAGG - Intergenic
1170798423 20:19570188-19570210 GGCCAGGAGGAGAGAGAGCAGGG + Intronic
1172010634 20:31844067-31844089 GGCAAGGGAGAGACTGGGCAGGG - Intergenic
1172941680 20:38658684-38658706 GGCAGGGGGCAGAGTGGGCAGGG + Intergenic
1173583022 20:44160478-44160500 GGCAAGGGCGGGAGTGGGCAAGG + Intronic
1173647502 20:44642595-44642617 GGCAAAGTGGAGAGGGGGCAGGG + Intronic
1173725989 20:45298160-45298182 GCCAAGGAGGAAGGTGGGCTTGG - Exonic
1175305788 20:57974625-57974647 GGCAAGGAGGCTGGTGGGCTGGG - Intergenic
1175549176 20:59805615-59805637 GGCTGGGGGGACAGTGGGCAGGG + Intronic
1175831587 20:61967661-61967683 GGAAAGGAGGAGAGGGGGAAAGG - Intronic
1176742288 21:10615810-10615832 GGCGAGGAGGGGAGGGGGCACGG + Intergenic
1178381639 21:32114706-32114728 AGCAAGGAGGAAGGTGGGCTGGG + Intergenic
1179505283 21:41835905-41835927 GGGAGGGAGGAGAGTGGGCGAGG - Intronic
1179505305 21:41835965-41835987 GGGAGGGAGGAGAGTGGGCGGGG - Intronic
1180240923 21:46504702-46504724 GGAAACGAGGAGAGTGGGGAGGG + Intronic
1181032449 22:20155034-20155056 GCCAAGGAGGATGGTGCCCAGGG - Intergenic
1181875188 22:25935250-25935272 GGTCAGGAGGAGAGTGAGCAAGG + Intronic
1182356213 22:29723282-29723304 GGCATGGAGGGCAGTTGGCAGGG + Intronic
1183464923 22:37974849-37974871 AGCAAGGAAGACAGTAGGCATGG - Intronic
1183704678 22:39469381-39469403 AGCAAGGAGGGCAGTGGGCATGG - Intronic
1184023798 22:41838777-41838799 GGCAAGGAAGATTGGAGGCAGGG + Intronic
1184489335 22:44800051-44800073 GGCATGGAGGATGGTCTGCAGGG + Intronic
1185320905 22:50199943-50199965 GCCAAGGAGGATGCTGGGAACGG + Intergenic
949977266 3:9472402-9472424 GGCACGGATTATGGTGGGCAGGG + Intronic
950116872 3:10456677-10456699 GACAAGGAGCCTGGTGGGCATGG - Intronic
950139477 3:10605405-10605427 GGCAAGGAGGCTATTGCCCAGGG - Intronic
950293627 3:11808465-11808487 GCCCAGGAGGAGAGTGGGCGTGG + Intronic
950477014 3:13221042-13221064 GGCAGGGAGGCCAGTGAGCAGGG + Intergenic
950620705 3:14203054-14203076 GGCAGGGAGGCCAGTCGGCATGG + Intergenic
951107293 3:18759934-18759956 GGTAAGGAGGATAGACAGCATGG + Intergenic
951752926 3:26057147-26057169 GGGAAGGAGTGAAGTGGGCAGGG - Intergenic
953088715 3:39701226-39701248 GGGGTGGAGGATAGTGGGAATGG + Intergenic
953142511 3:40242031-40242053 GGCAAGGAGGATAAAGGCAAGGG + Intronic
955101579 3:55854847-55854869 GGGAAGGAGGCTGGTGGGGAGGG + Intronic
955611789 3:60765458-60765480 GGGAATGAGAATAGTGGGTAAGG + Intronic
957030313 3:75233086-75233108 GGAAAGGTTGATGGTGGGCATGG + Intergenic
957040111 3:75329834-75329856 GGCCAGGAGGAAGGTGGGGATGG + Intergenic
957602478 3:82355922-82355944 AGCAAGGAGCACAGTGTGCATGG - Intergenic
959268200 3:104170708-104170730 GGCAAGGAGAATAGCTGGCAGGG + Intergenic
959917901 3:111838369-111838391 GGAAAGAGGGATTGTGGGCAGGG - Intronic
961044898 3:123701377-123701399 GGCCAGGAGGAAGGTGGGGATGG + Intronic
961452225 3:127007527-127007549 GGCAAAGAGGATAGGGAGCCTGG + Intronic
961537731 3:127580199-127580221 GGGAAGGAGGACAGTGGCCCAGG - Intronic
962238870 3:133733354-133733376 GGGAAGGAGGTTAGTAGTCAGGG - Intergenic
962740189 3:138357664-138357686 GGCCAGGCGGCCAGTGGGCATGG - Intronic
962869566 3:139476365-139476387 GGTAAGGAGGAGACTGGGGATGG - Exonic
963296552 3:143552964-143552986 GGCAAGTAGGAGCGTTGGCAGGG - Intronic
966321379 3:178704969-178704991 GGAAAGGATGATAGTGGTGATGG - Intronic
966863156 3:184241721-184241743 GGCCAGGTGGACAGTGGGCGGGG + Exonic
966888741 3:184391066-184391088 CGCAGGGAGGAGAGTGGCCATGG + Intronic
967043392 3:185714976-185714998 AACCAGGAGGCTAGTGGGCAGGG + Intronic
967215754 3:187208764-187208786 CTAAAGGAGGATATTGGGCATGG + Intergenic
969370436 4:6727877-6727899 GGCAAGGAGGAGAGGGGGAGGGG - Intergenic
969511847 4:7622583-7622605 GGCAAAGAGGAAGGTGGGCAGGG - Intronic
970647988 4:18145325-18145347 GGCAGGAAGGAGAGTGGGCAAGG - Intergenic
972840760 4:42927773-42927795 GGGAAGTAGGAAAGTGGGGAGGG + Intronic
973637246 4:52871495-52871517 GGGAAGGAGGACTGTGGCCATGG - Intergenic
974594698 4:64000215-64000237 GACTAGGTGGCTAGTGGGCAAGG + Intergenic
975122758 4:70746902-70746924 GGCAAGGAGAGATGTGGGCATGG + Intronic
975250578 4:72173928-72173950 GACTAGGTGGTTAGTGGGCAAGG - Intergenic
976906252 4:90240156-90240178 GGCCAGTAGAATAGTCGGCATGG + Intronic
978329376 4:107596198-107596220 GGCAAAGAGTCTAGTGGGCCAGG - Intronic
979401900 4:120259411-120259433 GGGAAGGAGGAAGCTGGGCAAGG + Intergenic
980244779 4:130224609-130224631 TGCAAGGAGCACAGTGGGAAGGG + Intergenic
980521141 4:133935843-133935865 GGCAGGAAGGGAAGTGGGCATGG - Intergenic
981643462 4:146972078-146972100 GGCTCGAAGGATAGTGGGCAGGG - Intergenic
982234901 4:153243152-153243174 GGCAAGGAGGGAAGTGGACTAGG + Intronic
983065269 4:163203193-163203215 AGCAGGGAGGAAAGTGGGAAGGG - Intergenic
983749144 4:171242670-171242692 GGGCAGGAGGGTAGTGGGCAAGG + Intergenic
984635086 4:182101607-182101629 GGCAGGGGGGATGATGGGCAGGG + Intergenic
985102040 4:186468040-186468062 GGGAAGAAGGAGAGTGGGGAAGG - Intronic
986240330 5:5954831-5954853 GGCAAGGAGGAAAGGGGGGAAGG - Intergenic
986575177 5:9204974-9204996 GGCAGGGAGGATAGAGGGGATGG - Intronic
986582552 5:9280343-9280365 GGCAAAGATGAAAGTGGGAAAGG + Intronic
987255738 5:16149140-16149162 GGTAAGGAGGACACTGGGCAAGG - Intronic
988080480 5:26409152-26409174 TGCAAGGAGAAAACTGGGCATGG - Intergenic
988481078 5:31631101-31631123 GGGAAGGAGGGAGGTGGGCAGGG + Intergenic
989459285 5:41678657-41678679 GGCTGGGAGGATGGGGGGCATGG - Intergenic
990849691 5:60188583-60188605 GGCAGGGAGGAGAGTGGAGATGG + Intronic
992367419 5:76106782-76106804 GGCAAGGGGGATTGTGAGTAGGG - Intronic
996009683 5:118468211-118468233 GACAAGTAGGATAGGGGGAAGGG - Intergenic
996683725 5:126257218-126257240 GGCATGGACTACAGTGGGCAGGG - Intergenic
998521331 5:142803624-142803646 GACAAGGAGGATGTTGGGAATGG + Intronic
998593433 5:143501950-143501972 GGGAGGGAGGATAGTAGGAAAGG - Intergenic
999318072 5:150596828-150596850 GGCAAGGAGGCTAGAAGGTAAGG + Intergenic
999385761 5:151153148-151153170 GGCAAAGAGGAAAGTGGTGATGG - Intronic
999590857 5:153143747-153143769 GGCAAGTTGGGTGGTGGGCAAGG - Intergenic
999869131 5:155731019-155731041 GGCCAAGAGGAGAATGGGCAGGG + Intergenic
999981673 5:156963674-156963696 GGCAAGGAGGCCAGGGGACAGGG - Intergenic
1001236683 5:170035693-170035715 GTCAAGGAGGAGGGTGGGGATGG + Intronic
1001653609 5:173331620-173331642 GGCAAGGAAAAAAGTGGGCATGG + Intergenic
1001859351 5:175039796-175039818 TCCAAGGAGGACAATGGGCAAGG - Intergenic
1001925451 5:175632964-175632986 CTCAAGGAGCAGAGTGGGCAAGG - Intergenic
1001944689 5:175769233-175769255 GGGTAGGAAGAGAGTGGGCACGG + Intergenic
1002294967 5:178225246-178225268 GGCAGGGAGGATAAGGGGCCTGG - Intronic
1003032993 6:2618913-2618935 GGCTAGGAGCACAGTGGGGAGGG - Intergenic
1003939950 6:11014571-11014593 GGCAAGGAGGATAGTGGGCATGG - Intronic
1003940418 6:11019647-11019669 GGCAAGGAGGATAGTGGGCATGG + Intronic
1004540461 6:16544712-16544734 GGCAAGGAGGAAAGCCTGCATGG - Intronic
1005991252 6:30903873-30903895 GGCCAGCATGTTAGTGGGCATGG - Intergenic
1006195913 6:32242266-32242288 AGCAAGCAGGACACTGGGCATGG - Intergenic
1006996272 6:38264238-38264260 GACAAGGAGGATACAGGCCAGGG + Intronic
1007387206 6:41528091-41528113 GGCGGGGAGGGAAGTGGGCAGGG - Intergenic
1007429893 6:41770751-41770773 GGCAGGGTGGGTGGTGGGCATGG + Exonic
1007527370 6:42508410-42508432 GGCAAGGAGGGTGGTTGGGATGG + Intergenic
1007543587 6:42672792-42672814 GGAAAGGAAGAAAGTGGGGAAGG - Intronic
1007618873 6:43199385-43199407 GGCAAGGAGAAGAGAGGGAAGGG + Intronic
1007629312 6:43263961-43263983 GGCAAGGTGGATAGTGCCAAGGG + Intronic
1008583168 6:52924579-52924601 GACAATGAGGAAAGTGGCCAAGG + Intergenic
1008737310 6:54561297-54561319 GTCAAGGAGCAAAGTGGACAGGG + Intergenic
1009195369 6:60678327-60678349 AGGAAGGAGAAGAGTGGGCAAGG + Intergenic
1013185279 6:107752226-107752248 GGGAAGGAGGATAGAGTGGAGGG + Intronic
1013418768 6:109947660-109947682 GGCATGGAGGGCAGGGGGCAGGG - Intergenic
1014286252 6:119502517-119502539 GGCCTGGAGGTTGGTGGGCAAGG - Intergenic
1015020406 6:128466578-128466600 AGCAAGGGGGATAGTAGGCATGG + Intronic
1016394683 6:143611006-143611028 GGTAAGGAGGATAGTGGCACTGG - Intronic
1019460219 7:1154262-1154284 GGCAGTGAGGAGAGTGGGGAGGG + Intronic
1019565470 7:1676674-1676696 GGGAAGGAGGATGCTGGGGAAGG + Intergenic
1019660161 7:2219665-2219687 GGCAAGGGGGGCAGAGGGCAGGG + Intronic
1020091723 7:5345684-5345706 GGCCTGGAGGAGAGTGGGCTGGG - Exonic
1021250784 7:18322888-18322910 GGAAAGGAGGATTCTGGGAAGGG + Intronic
1022174530 7:27860842-27860864 GGCAAAGAGGAAAGTGGGGATGG - Intronic
1022383325 7:29880969-29880991 AGCAAGGAGGATAGTGTGAGTGG - Intronic
1022489420 7:30805246-30805268 GTCAAGGAGGACTGTGGGCCTGG + Intronic
1022568785 7:31430710-31430732 AGCAGGGAGGATGGTGGACAGGG - Intergenic
1023609267 7:41957340-41957362 AGAAAGCAGGAGAGTGGGCAAGG - Intergenic
1024518788 7:50284591-50284613 GGCCAGCAGCATAGTGGGAATGG - Intergenic
1025983310 7:66425799-66425821 GGCAAGGGGGATAGTGGGGATGG + Intergenic
1026031893 7:66801515-66801537 GGCATGGGGGATAGTGGGGATGG - Intronic
1028920757 7:96307593-96307615 TGGAAGGAGGAAAGAGGGCATGG + Intronic
1029453738 7:100656568-100656590 GGCCAGGAGGAGATGGGGCAGGG + Intergenic
1029931574 7:104376745-104376767 GGCAAGGAGGAGTGTCGCCAAGG - Intronic
1030091243 7:105861067-105861089 GGGAAGGAGGATGAGGGGCAAGG + Intronic
1030161342 7:106511373-106511395 GGCAAGAGGCAGAGTGGGCAGGG - Intergenic
1031077613 7:117227962-117227984 GGCTAGAAGGATACTGGGGAGGG - Intronic
1031795100 7:126163644-126163666 GGGAGGGAAGAAAGTGGGCATGG - Intergenic
1032076199 7:128837274-128837296 GGCAGGGGGGAAAGGGGGCAGGG + Intronic
1033649032 7:143326651-143326673 GGCAAGGAGGATGGTGGGCAAGG + Intronic
1033650501 7:143339166-143339188 AGAAAGGAGGATAGTGGGAAGGG + Intronic
1033825426 7:145184101-145184123 TGCCAGGAGGATTGTGTGCAAGG + Intergenic
1034989881 7:155541732-155541754 GGCCAGGAGGACAGTGTGGATGG + Intergenic
1035389905 7:158497119-158497141 GGGAAGGAGGAGAGGGAGCAGGG - Intronic
1036937806 8:13021240-13021262 AGCAAGGAGGATGGTAGGGATGG - Exonic
1036942292 8:13063472-13063494 GGCAAGCAGGATAGACAGCAAGG + Intergenic
1038128449 8:24700931-24700953 GGCAAGGACTACACTGGGCAAGG - Intergenic
1038881991 8:31624948-31624970 GGTAAGTAGGATATTGAGCAGGG + Intergenic
1040671621 8:49698138-49698160 GAGAAGGAGGATGGTGGCCATGG - Intergenic
1043019360 8:74982281-74982303 GGTAAGGAGGAGGGTTGGCAAGG - Intergenic
1043926169 8:86039630-86039652 GACAAGCAGAATAGTGAGCAGGG - Intronic
1044445120 8:92266253-92266275 GACATGGAGGACAGTGGGGATGG + Intergenic
1044490539 8:92809080-92809102 GGCAATGAGCATAGGGGACAAGG + Intergenic
1044682028 8:94789556-94789578 GTTCAGGAGTATAGTGGGCATGG + Intronic
1045525936 8:102941322-102941344 GGCAAGGAGGAAAGTGCGGGTGG + Intronic
1045601115 8:103718148-103718170 GCCAAGGAGGATAATAGGCAAGG + Intronic
1045610105 8:103829714-103829736 GGGTAGGAGGAGAGTGAGCATGG + Intronic
1045620553 8:103972614-103972636 AGCAAGGAGGATAGGGTGCTTGG - Intronic
1046411914 8:113855983-113856005 GGAAAGGAGAATAGAGGGAATGG - Intergenic
1048204088 8:132401754-132401776 GACTAGGAGGAGGGTGGGCAGGG - Intronic
1048515457 8:135105270-135105292 GGCTAGGGGGATGGTGGGAATGG - Intergenic
1049471054 8:142775188-142775210 GGCCAGGAGGATGGGGGCCAGGG + Intronic
1049970549 9:818339-818361 GGCAAGGAGGATAGGAGGCAGGG - Intergenic
1051978709 9:22986736-22986758 CACTAGGAGGATAGTGGACAGGG - Intergenic
1052812155 9:33070889-33070911 GGTAAGAAGGAAAGTGGGGATGG + Intronic
1053323481 9:37120668-37120690 GGCAAGAAGGAGGGTAGGCAGGG - Exonic
1055428254 9:76217817-76217839 GGGAAGGACGTTAGTAGGCAAGG + Intronic
1056236582 9:84600649-84600671 GGTAAGGAGGAAAGAAGGCAAGG - Intergenic
1056307389 9:85303458-85303480 GGGAAGGAGGTTAGAGGGCCAGG + Intergenic
1057317229 9:93977454-93977476 AGGAAGGAGGAGAGTGGGCCTGG - Intergenic
1057742508 9:97724240-97724262 GGCAAGAAGGATTCTGGGCTGGG + Intergenic
1059340874 9:113597000-113597022 GGCAGGGAGGCAGGTGGGCAGGG - Exonic
1059518969 9:114921991-114922013 GGCAAGGAAGATGGTTGGGATGG - Intronic
1059922904 9:119177990-119178012 GGAAAGGTGGAGAGTGGGGAAGG + Intronic
1060599744 9:124869720-124869742 GGCAAGGAGGGAAGAGGGCGCGG - Intronic
1060740043 9:126092002-126092024 GGCAAGGAGGACATTGTGAAGGG + Intergenic
1061334998 9:129927302-129927324 GGAAAGGAGGATTGTGAGAATGG - Exonic
1062170452 9:135132111-135132133 GGCAAGGCGGGGTGTGGGCACGG + Intergenic
1062194128 9:135263871-135263893 GGGAAGGAGGGGAGAGGGCAGGG - Intergenic
1186349315 X:8727328-8727350 TGCAGGGACCATAGTGGGCAGGG - Intronic
1187294235 X:17983773-17983795 GACAGGGAGGATAGAGGGAAAGG + Intergenic
1187405062 X:18996575-18996597 GGAGAGGAGGAGAGTGGGAAGGG - Intronic
1187500257 X:19833296-19833318 GGCAAGGAGGACTGTGGGAAGGG - Intronic
1187981873 X:24765829-24765851 GGAAAGGAGGAAACTGGGGAAGG - Intronic
1188898552 X:35699217-35699239 GGCAAGATGGGTAGTGGGGAGGG + Intergenic
1189550446 X:42087233-42087255 GGAATGGAGGAAAGTGGGGAGGG - Intergenic
1189560351 X:42185708-42185730 GGCCAAGAGGACTGTGGGCAAGG + Intergenic
1190435438 X:50419910-50419932 GGCAAAGAGCACAGTGGTCAAGG + Intronic
1192174150 X:68875408-68875430 GGCAAGGAGGAGAGTGGTAGGGG + Intergenic
1192963533 X:76153758-76153780 GGTAAGGAGGGTACTGTGCATGG + Intergenic
1196353230 X:114757853-114757875 GGCAAGAAGTAGAGAGGGCAAGG - Intronic
1196498008 X:116345671-116345693 GGAAAGGAAAATAGTGGTCAAGG - Intergenic
1197127436 X:122963959-122963981 AGCAAGGAGAAGAATGGGCATGG + Intergenic
1197507639 X:127327488-127327510 GGCAAGGGGGAGTGTGTGCAGGG + Intergenic
1197654585 X:129102816-129102838 GGCAAGGAAGATTGGGGGAAGGG - Intergenic
1197756903 X:130001997-130002019 GGCAAGAAGGGTAGAAGGCAAGG + Intronic
1197892181 X:131278791-131278813 GGCAAGGAGGAGGGAGGGGAAGG - Intronic
1198364599 X:135928163-135928185 GGCAGGGAGGATATTGTGGATGG - Intergenic
1198714077 X:139537788-139537810 GGCAAGAAGGGTAATGGGGAGGG - Intronic
1199108451 X:143900900-143900922 GCTAAGAAGGATAGTGGGGAGGG + Intergenic
1199489146 X:148379548-148379570 GACAAGGAGGACAGAGGGAAGGG + Intergenic
1199747789 X:150784931-150784953 TGCAGGGCGGAGAGTGGGCAGGG + Intronic
1201743410 Y:17346536-17346558 GGCAGGGAAGAAATTGGGCAGGG + Intergenic
1202176325 Y:22102154-22102176 GACAAGGATGATAGGAGGCAAGG - Intergenic
1202215036 Y:22484230-22484252 GACAAGGATGATAGGAGGCAAGG + Intergenic