ID: 1003942497

View in Genome Browser
Species Human (GRCh38)
Location 6:11043791-11043813
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003942483_1003942497 28 Left 1003942483 6:11043740-11043762 CCCCAGAACTCCCGAGGCAGGGT 0: 1
1: 0
2: 0
3: 9
4: 135
Right 1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG No data
1003942490_1003942497 0 Left 1003942490 6:11043768-11043790 CCGCGCGCGGGAAACGCCGTTCT 0: 1
1: 0
2: 0
3: 0
4: 12
Right 1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG No data
1003942486_1003942497 18 Left 1003942486 6:11043750-11043772 CCCGAGGCAGGGTGTGTGCCGCG 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG No data
1003942487_1003942497 17 Left 1003942487 6:11043751-11043773 CCGAGGCAGGGTGTGTGCCGCGC 0: 1
1: 0
2: 1
3: 7
4: 151
Right 1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG No data
1003942484_1003942497 27 Left 1003942484 6:11043741-11043763 CCCAGAACTCCCGAGGCAGGGTG 0: 1
1: 0
2: 0
3: 7
4: 123
Right 1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG No data
1003942485_1003942497 26 Left 1003942485 6:11043742-11043764 CCAGAACTCCCGAGGCAGGGTGT 0: 1
1: 0
2: 0
3: 5
4: 112
Right 1003942497 6:11043791-11043813 CCGCTCCAGGCGTCGGCGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr