ID: 1003946711

View in Genome Browser
Species Human (GRCh38)
Location 6:11082815-11082837
Sequence CTGAAAATACACCTGAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003946711_1003946712 -3 Left 1003946711 6:11082815-11082837 CCAGGCTTCAGGTGTATTTTCAG No data
Right 1003946712 6:11082835-11082857 CAGCCGCCCCTTTATTCCTGTGG No data
1003946711_1003946718 10 Left 1003946711 6:11082815-11082837 CCAGGCTTCAGGTGTATTTTCAG No data
Right 1003946718 6:11082848-11082870 ATTCCTGTGGTGAGGCCCTTCGG No data
1003946711_1003946714 2 Left 1003946711 6:11082815-11082837 CCAGGCTTCAGGTGTATTTTCAG No data
Right 1003946714 6:11082840-11082862 GCCCCTTTATTCCTGTGGTGAGG No data
1003946711_1003946720 12 Left 1003946711 6:11082815-11082837 CCAGGCTTCAGGTGTATTTTCAG No data
Right 1003946720 6:11082850-11082872 TCCTGTGGTGAGGCCCTTCGGGG No data
1003946711_1003946719 11 Left 1003946711 6:11082815-11082837 CCAGGCTTCAGGTGTATTTTCAG No data
Right 1003946719 6:11082849-11082871 TTCCTGTGGTGAGGCCCTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003946711 Original CRISPR CTGAAAATACACCTGAAGCC TGG (reversed) Intergenic
No off target data available for this crispr