ID: 1003948456

View in Genome Browser
Species Human (GRCh38)
Location 6:11096178-11096200
Sequence ATTTTTCCACAGACGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 459
Summary {0: 1, 1: 2, 2: 12, 3: 82, 4: 362}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003948453_1003948456 2 Left 1003948453 6:11096153-11096175 CCAGGGACTTGTTTTGTGGAGAA 0: 1
1: 0
2: 26
3: 376
4: 1070
Right 1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG 0: 1
1: 2
2: 12
3: 82
4: 362
1003948447_1003948456 19 Left 1003948447 6:11096136-11096158 CCCCAACCTTTTTGGTACCAGGG 0: 69
1: 1071
2: 1609
3: 1284
4: 962
Right 1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG 0: 1
1: 2
2: 12
3: 82
4: 362
1003948451_1003948456 13 Left 1003948451 6:11096142-11096164 CCTTTTTGGTACCAGGGACTTGT 0: 1
1: 50
2: 696
3: 1387
4: 1470
Right 1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG 0: 1
1: 2
2: 12
3: 82
4: 362
1003948449_1003948456 18 Left 1003948449 6:11096137-11096159 CCCAACCTTTTTGGTACCAGGGA 0: 68
1: 1090
2: 1673
3: 1347
4: 901
Right 1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG 0: 1
1: 2
2: 12
3: 82
4: 362
1003948450_1003948456 17 Left 1003948450 6:11096138-11096160 CCAACCTTTTTGGTACCAGGGAC 0: 69
1: 1058
2: 1747
3: 1392
4: 931
Right 1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG 0: 1
1: 2
2: 12
3: 82
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003948456 Original CRISPR ATTTTTCCACAGACGGAGCA GGG Intronic
901080503 1:6581165-6581187 AGTTTCCCACAGAGGGAGGAGGG - Exonic
901304535 1:8223161-8223183 ATTTTTCCACAGCCGGGGGCTGG - Intergenic
901895285 1:12306748-12306770 ATTTTTCCACAGACAGGGTTGGG + Intronic
902592736 1:17486637-17486659 ATTTTTCCACAGACTGAGTCGGG - Intergenic
903842083 1:26250432-26250454 ATTTTTCCACAGACGATGGTTGG - Intronic
904353053 1:29921373-29921395 ATTTTTCCACAGACGGGGGTGGG + Intergenic
905027045 1:34857793-34857815 ATTTTTCCACAGATGGGGGTTGG + Intronic
905998259 1:42401034-42401056 ATTTTTCCACAGATGGGGGTGGG + Intronic
906511861 1:46414548-46414570 AGTTTTCCAGAGACTGAGCTAGG + Intergenic
907911215 1:58828328-58828350 ATTTTTCCATAGATGGGGCAGGG - Intergenic
909447828 1:75767185-75767207 ATTTTTCCACAGACACAGTGGGG - Intronic
910545206 1:88408106-88408128 ATTTTTACACAGATGAAGGAGGG + Intergenic
910686747 1:89925435-89925457 ATTTTTCCATGGACGGGGGAGGG - Intronic
913173556 1:116253959-116253981 ATTTTTCCATGGATGGGGCAAGG - Intergenic
913270016 1:117084066-117084088 ATTTTTCCAATGATGGATCAGGG - Exonic
914753434 1:150550360-150550382 ACTTTTCCAGAGAGGGAGCCAGG + Intronic
918460141 1:184767995-184768017 TTTTTTCCACGGATGGGGCAGGG - Intergenic
919030973 1:192242361-192242383 ATTTTTACACATAGGCAGCAAGG + Intergenic
919329614 1:196153811-196153833 ATTTTTCCAAAGACATACCATGG - Intergenic
920759020 1:208763718-208763740 ATTTTTGTATAGACTGAGCAGGG - Intergenic
921151863 1:212409139-212409161 ATTTTTCCACAGATGGAGGTTGG - Intronic
921442768 1:215207404-215207426 ACTTTTCCACGGACAGAGCTGGG - Intronic
921853835 1:219959378-219959400 GTTTCTGCACACACGGAGCATGG - Intergenic
922010214 1:221575749-221575771 ATTTTTCCATGGATGGAGGAGGG - Intergenic
922254422 1:223880588-223880610 ATTTTTCCACAGATGCAGGCGGG + Intergenic
922293257 1:224226818-224226840 ATTTTTCCACAGACAGGGTCAGG + Intergenic
922607627 1:226900362-226900384 AATTGTCCACAGAGGGGGCAGGG - Intronic
922781417 1:228256049-228256071 ATTTTTCCACAGATGGGGGTTGG - Intronic
922865350 1:228856022-228856044 ATTTTTCCACAGACCAGGGATGG - Intergenic
924893391 1:248308816-248308838 ATTTTTCCACTGATTGGGCAGGG - Intergenic
924895365 1:248332843-248332865 ATTTTTCCACTGATGTGGCAGGG - Intergenic
1063499457 10:6539681-6539703 ATTTTTCCACAGACTGGGGTGGG - Intronic
1063604669 10:7512207-7512229 ATTTTTCCACAGACAGTGGAGGG + Intergenic
1064233654 10:13553277-13553299 ATATTTTCACAGGCTGAGCATGG + Intergenic
1064269492 10:13852111-13852133 ATTTTTCCACAGATGGGGTGTGG - Intronic
1064646382 10:17464350-17464372 TTTTTTCCACAGATGGAGTGGGG - Intergenic
1065045227 10:21741639-21741661 ACTTTTCCACAGAAGTAACATGG - Intronic
1065939562 10:30551758-30551780 ATTTTTCCACAGACTGGGGTGGG + Intergenic
1066316863 10:34256389-34256411 AGGTTACCACAGCCGGAGCAGGG + Intronic
1066397515 10:35040712-35040734 ATTTTTCCACAGACGGAGTGCGG + Intronic
1067224662 10:44367837-44367859 ATTTTTCCACGGGCAGTGCAGGG - Intergenic
1067315227 10:45155226-45155248 ATTTTTCCACAGACCATGGATGG - Intergenic
1067435806 10:46276178-46276200 AATTTTCCACAAATGGAGCTGGG - Intergenic
1068194129 10:53694379-53694401 TTTTTTCCACAGACGGGGGTAGG + Intergenic
1068383989 10:56299310-56299332 GTTTTTCCACAGACAGAGTCGGG - Intergenic
1068861791 10:61855169-61855191 ATTTTTCCACAGACGTAGGTGGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1069357268 10:67601263-67601285 ATTTTTCCACAGATGGTGGATGG + Intronic
1069605067 10:69733700-69733722 ATTTTTCCATAGACGGGGTGGGG - Intergenic
1071801260 10:89064246-89064268 ATTTTTCCAGAGAGGGGTCATGG - Intergenic
1071829406 10:89356783-89356805 GTTTTTCCACAGACTGGGCAGGG - Intronic
1072056050 10:91756957-91756979 ATTTTTCCACAGATGGGGATGGG + Intergenic
1072256883 10:93629610-93629632 ATTTTTCCACAGAATGAGGGTGG + Intronic
1072424536 10:95318799-95318821 ATTTTTCCACAGATGGGGTGGGG + Intronic
1073682498 10:105719421-105719443 ATTTTTCCACAGATGGAGGTGGG + Intergenic
1074124556 10:110517684-110517706 ATTTTCCCACAGACGGGGTTCGG - Intergenic
1075145913 10:119882888-119882910 AATTTTCCACTGTCAGAGCAGGG + Intronic
1075231545 10:120684278-120684300 AATTGTCCACAGGCTGAGCAGGG - Intergenic
1075500921 10:122973408-122973430 ATTTATCCACAGAGGGAAAATGG - Intronic
1076201312 10:128560848-128560870 ATTTTTCCCCAGATGGCGGAGGG + Intergenic
1076415072 10:130280223-130280245 ATTTTTCCACAGACCCAGGGTGG - Intergenic
1077087306 11:760289-760311 ATTTTTCCTCTGTTGGAGCAGGG + Intronic
1077860846 11:6178480-6178502 ATTTTTCCACAGACAGGGGAAGG - Intergenic
1078229790 11:9429972-9429994 ATTTTTCCACAGATGGTCCGGGG + Intronic
1078807679 11:14722466-14722488 CTTTTTCCAAAGACGAAACAAGG + Intronic
1078812690 11:14784127-14784149 ATTTTTCCACAGACTGGGTAGGG - Intronic
1079785949 11:24673102-24673124 ATTTTTCCATGGATGGAGGAAGG - Intronic
1080242876 11:30147241-30147263 ATTTTTCCACAGATGGGGGTGGG + Intergenic
1080492596 11:32782303-32782325 ATTTTTCCACAGACTGGGGCTGG - Intronic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1080931175 11:36812916-36812938 AATTTTGCACAGACTGAGCTTGG - Intergenic
1081045272 11:38266591-38266613 GTTTTTCCACAGACAGTGCTGGG + Intergenic
1081552564 11:44127554-44127576 ATTTTTCCACAGACTGGGTTTGG - Intronic
1083512213 11:63220446-63220468 ATTTTTCCAAAGACAGAGTTTGG - Intronic
1083576675 11:63796899-63796921 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1086485944 11:87301761-87301783 ATTTTTCCAAAGACGATGAATGG - Intronic
1086795881 11:91101540-91101562 ATTTTTCCATAGACAGAGCAAGG - Intergenic
1087160395 11:94942887-94942909 ATTTTTCCACAGATGGTGGGTGG + Intergenic
1088341488 11:108772832-108772854 ATTTTTCCACTGACAGGGGATGG - Intronic
1089249175 11:117144956-117144978 ATTTTTCAACAAAAGGAGGAGGG - Intronic
1089330304 11:117684867-117684889 ATTGCTCCACAGAGGGAGGAAGG + Intronic
1089408838 11:118221387-118221409 ATTTTTCCACAGACCAGGGAGGG + Intronic
1089512760 11:119010891-119010913 GTTTTTCCACAGATGGACCCAGG + Intronic
1090671227 11:128946911-128946933 ATTTTTCCATGGACTGAGGAGGG + Intergenic
1091647535 12:2285121-2285143 GTGTTTCTACAGAGGGAGCAAGG - Intronic
1091755327 12:3047612-3047634 ATTTTTCCACGGATGGAGCGGGG - Intergenic
1091792106 12:3277852-3277874 AATTTCCCACAGATGGAGAAAGG - Intronic
1092554554 12:9543196-9543218 ATTTTTCCACAGATGGGGTGGGG + Intergenic
1092745885 12:11672153-11672175 ATTTTGCGACAGAAGGAACAGGG - Intronic
1093260086 12:16925244-16925266 ATTTTTCCATGGACGGAGTGGGG + Intergenic
1093411897 12:18877602-18877624 ATTTTTCCACAGATGGGGTAAGG + Intergenic
1094167445 12:27457042-27457064 ATTTTTCCACAGACAGTGGGAGG - Intergenic
1094517545 12:31147439-31147461 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1094719094 12:33044237-33044259 ATTTTTCCACGGATGGGGGATGG + Intergenic
1094747644 12:33364114-33364136 ATTTTTCCACAGACTGGGATGGG - Intergenic
1095393975 12:41742035-41742057 ATTTTTCCACAGATGGTGGGAGG + Intergenic
1095574055 12:43714217-43714239 ATTTTTCCATGGACGGGGCAGGG - Intergenic
1096431751 12:51550167-51550189 ATTTTGCCACAGACAGGGCAGGG - Intergenic
1096879681 12:54657741-54657763 ATTTTTCCATACACGGAGCTGGG + Intergenic
1098606707 12:72399174-72399196 ATTTTTCCACAGACAGAGGTGGG - Intronic
1098609922 12:72443966-72443988 ATTTTGCCAAAGACAGAGCCTGG + Intronic
1098846991 12:75549942-75549964 ATTTTTCCAGTGAGGGGGCAAGG + Intergenic
1099863531 12:88249349-88249371 ATTTTTCCACAGACGGGTTGGGG - Intergenic
1100324816 12:93530950-93530972 ATTTTTCCACAGACTGGGGTTGG + Intergenic
1100755868 12:97750397-97750419 ATTTTTCCATAGACTGGGGATGG + Intergenic
1100993684 12:100279149-100279171 GTTTTTCCACAGATGGGGGATGG + Intronic
1101284072 12:103291486-103291508 ACTGCTCCACAGACAGAGCAGGG + Intronic
1101364958 12:104063108-104063130 ATTTTTCCACGGACTTGGCAGGG - Intronic
1101861118 12:108483256-108483278 ATTTTTCCACGGACGGTGGGTGG - Intergenic
1103226375 12:119291520-119291542 ATTTTTCCACAGACGGGGTCAGG - Intergenic
1103458418 12:121085453-121085475 GCTGTTCCACAGACAGAGCAGGG - Intergenic
1104799099 12:131541170-131541192 ATTTTTCCACAGTGAGACCATGG - Intergenic
1105500854 13:20970508-20970530 ATTTTTCCATGGACGGGGAAGGG + Intergenic
1106457187 13:29937670-29937692 ATTTTTCCACAGATGGGGTCCGG - Intergenic
1106474310 13:30084301-30084323 ATTTTTCCACAGATGGGGTGGGG - Intergenic
1106854248 13:33830935-33830957 ATTTTTCCATGGACTGGGCAGGG + Intronic
1107895347 13:44956391-44956413 ATTTTTCCAAAGACAGAGGGTGG + Intronic
1108119759 13:47171994-47172016 ATTTTTCCATGGAAGGAGTAGGG + Intergenic
1108222653 13:48252563-48252585 ATTTTTCCACAGACAGACTGAGG - Intronic
1108345866 13:49546434-49546456 ATTTTTCCACGGACCGAGGCGGG + Intronic
1108487138 13:50938536-50938558 ATTTTTCCATGGATGGGGCAGGG + Intronic
1110175404 13:72549871-72549893 ATTTTTCCCCAGAGGGATCTTGG - Intergenic
1110754239 13:79152749-79152771 ATTTTTCCACAGACTGAGGTGGG - Intergenic
1111654239 13:91132187-91132209 ATTTTTCCACGGACTGTGGAGGG + Intergenic
1111861636 13:93714730-93714752 GCTTCTCCACAGATGGAGCAAGG + Intronic
1112664553 13:101554564-101554586 AATGTTCCACAGACGCAGCATGG - Intronic
1114576606 14:23719989-23720011 ATTTTTCCACAGATGGAGCAGGG - Intergenic
1115788565 14:36854364-36854386 ACTTTTCCCCAGATGGAGCTAGG + Intronic
1117767743 14:59100476-59100498 ATTTTTCCACAGACTGGGTCGGG + Intergenic
1118729558 14:68656747-68656769 AATTTTTCACAGACACAGCAAGG + Intronic
1118943046 14:70356188-70356210 ATTTTTCCACAGATGGTGGCGGG + Intronic
1119396548 14:74330332-74330354 TTTTTTCCCCAGAAAGAGCAGGG - Intronic
1123009398 14:105340440-105340462 GTTTTTCCACAGACGGTGATGGG + Intronic
1123065054 14:105614490-105614512 ATTTTTCCACAGACCAAGATCGG - Intergenic
1124574109 15:30892648-30892670 ATTTTTCCACAGATGGGGTAAGG - Intergenic
1125130411 15:36278470-36278492 CTCTTCCCACAGAGGGAGCAGGG - Intergenic
1125499715 15:40232028-40232050 GTTTTTCCACAGATGGGGGATGG + Intergenic
1126037985 15:44565330-44565352 ATTTTTCCACAGACTGGGAGGGG + Intronic
1127441885 15:59017152-59017174 ATTTTTCCACAGACCCAGGGTGG - Intronic
1127681561 15:61303098-61303120 ATTTTTCCATGGACAGAGCTGGG - Intergenic
1128014829 15:64334381-64334403 ATTTTTCCACAGACTGGGGGTGG + Intronic
1128042404 15:64586653-64586675 ATTTTTCCACAGACAGAGGGGGG - Intronic
1128110527 15:65073190-65073212 GTTTTTCCACAGACAGCGGAGGG + Intronic
1128220843 15:65967504-65967526 ATTCTTCTACAGACAGGGCAGGG + Intronic
1129218103 15:74113012-74113034 ATTTTTCTACAGACGGGGTCAGG + Intronic
1129406256 15:75320565-75320587 ATTTTTCCACAGACGGGGTTGGG - Intergenic
1129735216 15:77957054-77957076 ATTTTTCCACAGACGGGGTTGGG + Intergenic
1131080346 15:89529286-89529308 ATTTTTCCATGGAGGGAGTAGGG - Intergenic
1131794918 15:96006508-96006530 ATTTTCCCACAGAAGCAACAAGG + Intergenic
1132032118 15:98446852-98446874 GTTTTTCCACGGATGGGGCAGGG - Intronic
1133293464 16:4737788-4737810 ATTTGTCCACAGTCGGACTATGG + Exonic
1133968008 16:10545782-10545804 ATTTTTCTACAGACTGGGGAGGG - Intronic
1133977311 16:10608492-10608514 ATTTTTCCACAGATGGGGGTTGG - Intergenic
1136177144 16:28524981-28525003 GCTGTTCCACAGACAGAGCAGGG - Intergenic
1137459980 16:48651491-48651513 ATTTTTCCACGGACAGTGTAGGG + Intergenic
1138248022 16:55481131-55481153 ATTATTCCATAGACAGAGCAGGG + Intronic
1138731300 16:59198009-59198031 ATTTTTCCACGGATGGGGCGGGG + Intergenic
1141144453 16:81519140-81519162 ATTTTTTAACAGAAGTAGCAGGG + Intronic
1143279481 17:5741809-5741831 ATTTTTCCACGGACGGGGGTGGG + Intergenic
1144713616 17:17419550-17419572 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1146116272 17:30142325-30142347 ATTTTTTTAGAGACGGGGCAGGG + Intronic
1152014580 17:77741994-77742016 GTTTTTCCACAGACAGGACAGGG + Intergenic
1153693321 18:7615685-7615707 ATTTTTCCACAGATGGGGTGGGG + Intronic
1155736113 18:29224526-29224548 ATTTTTCCAGCGACAGGGCAGGG - Intergenic
1155908299 18:31478795-31478817 ATTTTTCCACAGACGGCGGCAGG + Intergenic
1156053026 18:32961586-32961608 ATTTTTCCACAGACAGAGCAGGG + Intronic
1157171409 18:45409818-45409840 ATTTTTCCACAGACCGGGGTTGG + Intronic
1157449901 18:47778015-47778037 ATTTTTCCGCAGACTGGGGAGGG + Intergenic
1157513848 18:48297040-48297062 AATTTTCCACAGACGGGGTGGGG - Intronic
1157768987 18:50327805-50327827 ATTTCTCCACAGACCGGGGAAGG + Intergenic
1157986886 18:52448282-52448304 ATTTTTCCACAGAGGGGCCAGGG - Intronic
1158568325 18:58574685-58574707 ATTTTTCCACAGCCGGAACGGGG - Intronic
1159033727 18:63257573-63257595 ATTTGTCCTCAGACGAAGAATGG - Intronic
1159540654 18:69770617-69770639 ATTGTTCCACAAAAAGAGCAAGG - Intronic
1159937271 18:74379241-74379263 ATTTTTCCACAGACCAAGGTTGG + Intergenic
1160334259 18:78023490-78023512 ATTTTTCCACAGACTGGGAGCGG + Intergenic
1161885127 19:6988689-6988711 CTTTTTCAAGAGACAGAGCATGG - Intergenic
1161976284 19:7609573-7609595 ATTTTTCCACAGATGGAGGCAGG + Intronic
1163780049 19:19241503-19241525 ATTTTTACACAGCGGGAGAAGGG - Intronic
1164450210 19:28355363-28355385 ATTTTTCCACAGACTAGGGAGGG - Intergenic
1165235835 19:34420893-34420915 ATTTTTTCACAGACTGAGGTGGG + Intronic
1165242478 19:34479903-34479925 ATTTTTCCACAGACAGGGATGGG - Intergenic
925744182 2:7030700-7030722 GTTTTTCCACAGACTGGGCAGGG + Intronic
926286547 2:11493292-11493314 ATTTTTCCACAGACAGGGTGTGG + Intergenic
927228063 2:20789876-20789898 ATTTTTCCACAGACTGGGGAGGG - Intronic
928660294 2:33495243-33495265 GTTTTTCCACAGACAGGGCAGGG + Intronic
928675259 2:33644670-33644692 ATTTTTCCACAGACTGGGAGTGG - Intergenic
929008302 2:37416526-37416548 ATTTTTCCACAAAGGGAGGGTGG - Intergenic
929174636 2:38963884-38963906 ATTTTTCCACAGACTGCGGAGGG + Intronic
932936776 2:76112742-76112764 ATCTTATCATAGACGGAGCATGG + Intergenic
933056998 2:77683133-77683155 ATTTTTCCACAGATGGGGCACGG + Intergenic
933332533 2:80912561-80912583 ATTTTTCCACAGTCAGATCTTGG - Intergenic
933927130 2:87104276-87104298 ATTTTTCCACAGATGGGGCACGG + Intergenic
934954055 2:98601915-98601937 ATCTTTCCACGGACGGGGAAGGG - Intronic
935565161 2:104598525-104598547 ATTTTTCCACAGACTGGGTAGGG + Intergenic
936034540 2:109100437-109100459 ATTTTTCCACGGACTGAGATGGG - Intergenic
936083126 2:109448774-109448796 ATTTTTCCACAGACTGAGGCAGG - Intronic
937421526 2:121760311-121760333 ATTTTTCCACAGAAGGGGGGCGG - Intronic
937850333 2:126626679-126626701 ATTTTTCCACAGACTGGGTGGGG + Intergenic
939370428 2:141292236-141292258 ATTTTTCCACAGACCGGGATGGG - Intronic
940453269 2:153867539-153867561 ATTTTTCCACAGACTGGGAGAGG + Intergenic
940789171 2:158013698-158013720 ATTTTTCCTGAGAAGGAGAAGGG + Intronic
940948463 2:159645381-159645403 ATTTTCCCACAGATGGAGCAAGG + Intergenic
940990698 2:160093132-160093154 GTTTTTCCACAGACTGGCCAAGG + Intergenic
941447720 2:165623446-165623468 ATTTTTCCACGGACTGGGGAGGG - Intronic
941676269 2:168346344-168346366 ATTTTTCCACAGACCAGGCAGGG - Intergenic
942002668 2:171664205-171664227 ATTTTTCTACACACTGAGCAGGG - Intergenic
942549810 2:177103629-177103651 ATTTTTCCACAGACCGGGCTGGG + Intergenic
942993593 2:182233279-182233301 ATTTTTCTACAGACTGAGTTGGG + Intronic
943648839 2:190435068-190435090 ATTTTTCCTCAGATGGAGAGGGG - Intronic
944069463 2:195653020-195653042 ATTTTTCCACAGATGGGGGTGGG - Intronic
944777431 2:202981150-202981172 ATTTTTCCACAGACCCAGGGTGG + Intronic
945635192 2:212340313-212340335 ATTTTTCCACAGACAGAATAGGG + Intronic
945933450 2:215879804-215879826 ATTTTTCCACAGATGGTGGAGGG + Intergenic
946739797 2:222790248-222790270 ATTTTTCCACAGACGGTGGCAGG + Intergenic
946971726 2:225100854-225100876 ATCCTTCCTCAGACAGAGCAAGG - Intergenic
948535789 2:238645686-238645708 ATTTTTCCACAGACCGGGGAAGG - Intergenic
948539806 2:238682525-238682547 ATTTTTCCACAGATGGGGCTGGG + Intergenic
948926328 2:241101047-241101069 ATTTTTCCACAGACTGGTGAGGG + Intronic
1169031164 20:2408228-2408250 CTGGTTCCACAGACAGAGCAAGG - Intronic
1169254614 20:4087259-4087281 ATTTTTCCTCAGACGGGGTAGGG + Intergenic
1169360693 20:4946312-4946334 TTTTTTCTACAGTCAGAGCAGGG - Intronic
1171100917 20:22383283-22383305 ATTTTTCTACAACCGGAACAGGG - Intergenic
1174868938 20:54165499-54165521 ATTTTTCCATGGACAGGGCAGGG - Intronic
1174906459 20:54557262-54557284 ATTTTTCCACAGACGGGGTTGGG + Intronic
1176308532 21:5137055-5137077 ATTTTTCCACAGACAGGGTTGGG - Intronic
1179057118 21:37946426-37946448 ATTTTTCCACAGACCAGGGATGG - Intergenic
1179848527 21:44124977-44124999 ATTTTTCCACAGACAGGGTTGGG + Intronic
1180936182 22:19626755-19626777 ATTTTTCCACAGACCGAGGGTGG - Intergenic
1181020111 22:20095653-20095675 ATTTTTCCACAGACGGTGTTGGG + Intronic
1181235680 22:21446495-21446517 ATTTTGCCACAGATGTTGCAGGG - Exonic
1181846830 22:25717010-25717032 ATTTTTCCACAGACGGGGATGGG - Intronic
1183716934 22:39538562-39538584 CCTTGTCCACAGATGGAGCAGGG - Intergenic
1184706306 22:46215943-46215965 ATTTTTCCACAGATGGGGGTGGG - Intronic
949293698 3:2495759-2495781 ATTTTTCCACGGACCAGGCAAGG - Intronic
949333781 3:2951238-2951260 ATTTTTCCACAGATGGCGGGTGG + Intronic
949602389 3:5614195-5614217 ACTGTTCCACAGATAGAGCAGGG - Intergenic
951551427 3:23878909-23878931 ATTTTTCCACAGATGGGGGGTGG - Intronic
951553621 3:23899024-23899046 ATTTTTCCACAGATGGAGATGGG - Intronic
952248705 3:31627382-31627404 ATTTTTCCACGGATGGCGGAGGG - Intronic
952459005 3:33504656-33504678 ATTTTTCCACGGATGGGGAAGGG + Intronic
953227422 3:41033443-41033465 ATTTTTCCACGGATGGGGGAAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953707015 3:45238882-45238904 ATTTTTCCACACATGGGGTAGGG - Intergenic
954628415 3:52035410-52035432 ATGTTCCCACAGAGGGAGCGAGG - Intergenic
954725032 3:52601309-52601331 ATTTTTCCACAGACAGGGATGGG + Intronic
955141502 3:56274307-56274329 ATTTTTCCACAAACAGGGCTGGG - Intronic
956335819 3:68162270-68162292 ATTTTTCCACAGATGGGGTTGGG + Intronic
957346357 3:78966200-78966222 ATTTTTCCACAGACAGAGAGGGG - Intronic
957783096 3:84845049-84845071 ATTTTTCCATGGATGGTGCAAGG - Intergenic
957801585 3:85090885-85090907 ATTTTTCCACAGATGGAAAGGGG - Intronic
957833519 3:85554094-85554116 ATTTTTCCACAGAAGTAGTCAGG + Intronic
960070647 3:113426242-113426264 CTTCTTCCACAGCTGGAGCAGGG + Exonic
960086139 3:113593462-113593484 ATTTTTCCACAGACGGGGGTGGG - Intronic
960515977 3:118603243-118603265 AAGTTTCCACAGACTGAGGAAGG - Intergenic
960796318 3:121492040-121492062 ATTTTTCCACAGACCGGGGGTGG - Intronic
961727263 3:128939718-128939740 ATTTTTCCACGGACGGGGTTGGG + Intronic
961842044 3:129722408-129722430 ATTTTTCCACAGATGGGGTCGGG - Intronic
962110774 3:132444225-132444247 ATTTTTCCATGGACAGGGCAGGG - Intronic
962468842 3:135687198-135687220 ATTTTTCCACAGACTGGGCAGGG - Intergenic
963998000 3:151733435-151733457 ATTTTTCCATAGACTAAGCCTGG - Intergenic
964209624 3:154212579-154212601 ATTTTTCCACAGACGGGTGGGGG + Intronic
964264034 3:154873925-154873947 ATTTTTCCACAGATGGGGTCAGG - Intergenic
965517549 3:169637842-169637864 ATTATTCCACACACAGTGCAAGG + Intronic
965971170 3:174558329-174558351 GTTTTTCCACAGACTGGGTACGG + Intronic
966217900 3:177521246-177521268 ATTTTTCCATGGACGGGGGAGGG + Intergenic
966222781 3:177566994-177567016 ATTTTCCCATAGACAGGGCAGGG - Intergenic
966358439 3:179107447-179107469 ATTTTTCCACAGACTGGGGTAGG + Intergenic
967813636 3:193781102-193781124 AATTTTCCCCAGACGGGGCATGG + Intergenic
970038807 4:11772501-11772523 ATTTTTCCACAGACTGGGATGGG + Intergenic
970328846 4:14957769-14957791 CTTTCTCCACAGAAGGAGGAAGG + Intergenic
970900485 4:21152902-21152924 ATTTTTCCACAGACAGGGTTGGG - Intronic
970929855 4:21496892-21496914 ATTTTTGCACAGACAGAGCAGGG - Intronic
972744837 4:41922761-41922783 ATTTTTCCACAGACGGGAGTAGG - Intergenic
973117467 4:46478878-46478900 ATTTTTCCACGGACGGGGATGGG - Intergenic
973212458 4:47631672-47631694 ATTTTTCCACAGACTGGGATGGG - Intronic
974144810 4:57934076-57934098 ATTTGTCCCCAGGTGGAGCAAGG - Intergenic
974289270 4:59910242-59910264 ATTTTGCCTCAGGCAGAGCAGGG - Intergenic
975725328 4:77285957-77285979 ATTTTTCCACAGAAGGGTCTGGG + Intronic
976342349 4:83959249-83959271 ATTTTTCCACAGACAGGGAGTGG + Intergenic
976623427 4:87152652-87152674 ATTTTGCCACGGACAGGGCAGGG + Intergenic
977235181 4:94499948-94499970 ATTTTTCCACAGGTGGGTCAGGG - Intronic
978416251 4:108479702-108479724 ATTTTCCCACATAGGAAGCATGG - Intergenic
979485306 4:121263723-121263745 TTTTTTGCACAGATGGGGCAAGG + Intergenic
979729262 4:124003941-124003963 ATTTTTGAACAGAGGGAGGAAGG + Intergenic
979920797 4:126493414-126493436 ATTTTTCCACAGATGAAGTAGGG + Intergenic
980501115 4:133655629-133655651 GTTTTTCTACAGATGGGGCATGG + Intergenic
980910860 4:138993108-138993130 ATTTTTCCACGGACGGGGTGGGG - Intergenic
981755923 4:148141879-148141901 AATTTTCCACAGACCTGGCAGGG - Intronic
981767600 4:148269052-148269074 ATTGTTCCACAAACAGAACATGG - Intronic
981786308 4:148483110-148483132 ATTTTTCCACAGACTGGGGTGGG - Intergenic
982086303 4:151840212-151840234 ATTTTTCCACAGACTGGGGGTGG - Intergenic
982858221 4:160412719-160412741 ATTTTTCCACAGACTGCGTGGGG - Intergenic
983251818 4:165354241-165354263 ATTTTTTCACAGACGGGGTGGGG + Intergenic
983296964 4:165878592-165878614 ATATTCCCTCAGACTGAGCAAGG + Intronic
983700095 4:170581397-170581419 ATTTTTCCACAGAAGGGGCCAGG + Intergenic
984072933 4:175139036-175139058 ATTTTTCCACAGACTGGGGTGGG + Intergenic
984609289 4:181819594-181819616 AATTTTCCACAGATGGAGGGTGG + Intergenic
985530012 5:428583-428605 ATTTTTCCACAGACTGGGAGTGG + Intronic
985624028 5:975278-975300 ATTTTTCCACTGATGGAGAAGGG - Intergenic
985624078 5:975686-975708 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985624102 5:975890-975912 ATTCTTCCACTGATGGAGAAGGG - Intergenic
985887315 5:2689634-2689656 ATTTTTCCATAGATGGGGCAAGG - Intergenic
986083053 5:4414099-4414121 ATTTTTCCTCTGACTGAGAAGGG - Intergenic
986197998 5:5555479-5555501 ATTTTTCCATGGACAGAGAAGGG - Intergenic
986232319 5:5877643-5877665 ATTTTTCCACAGAAGAACCTGGG + Intergenic
986306872 5:6522736-6522758 ATTTTTCCAGAGATGGAGGCTGG + Intergenic
986404323 5:7410737-7410759 TTTTTTCCACAAAGGGAGGAGGG + Intronic
987035250 5:14012807-14012829 GTTTTTCCACAGGTGGGGCAGGG + Intergenic
987134977 5:14892002-14892024 ATTTTTCCGCAGATGGAGTAGGG - Intergenic
988390047 5:30616172-30616194 ATTTTTCCACGGATGGAGGGGGG - Intergenic
988427129 5:31076707-31076729 ATTTTTCAAGAGACGCATCAAGG + Intergenic
988560838 5:32279703-32279725 ATTTTTCCACGGACCTGGCAGGG + Intronic
988808161 5:34759763-34759785 ATTTTTCCACAGACCAGGTACGG - Intronic
989089076 5:37710503-37710525 ATATTTCCACAGACAGGGCCAGG + Intronic
990650836 5:57897867-57897889 ATTTTTCCACGGATGGAGGTTGG + Intergenic
991066235 5:62427759-62427781 ATTTTTCCACAGATGGGGCAGGG - Intronic
991172665 5:63646599-63646621 ATTTTTCCACAGATGGGGTGGGG + Intergenic
991625242 5:68594299-68594321 ATTTTTCCACAGATGGGGGTGGG - Intergenic
992211502 5:74484194-74484216 ATTTTTCCATGGACGGTGGAGGG - Intergenic
992613722 5:78530438-78530460 ATTTGTCTACACACGGAACAGGG + Intronic
993037264 5:82771422-82771444 ATTTTTCCACAGACCAGGGACGG + Intergenic
993140373 5:84025574-84025596 ATTTTTCCACAGACTGGGTTGGG - Intronic
993855261 5:93066379-93066401 ATTTTTCCACAGATGGGGGTTGG - Intergenic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994938216 5:106284378-106284400 ATTTTTCCACGGATGGGGTAGGG + Intergenic
995548758 5:113258615-113258637 ATTTTTCCACAGACAGTGGCAGG - Intronic
996228326 5:121029982-121030004 ATTTTTCCACAGACTGTGGTGGG + Intergenic
997963756 5:138341578-138341600 ATTTTTCCACCGATAGAGAAGGG + Intronic
998008064 5:138670685-138670707 ATTTTTCCACAGACGGAGGGAGG + Intronic
998915792 5:147010284-147010306 ATTTTTCCACAGACTGGGGCAGG + Intronic
1000749864 5:165081217-165081239 ATTATTCCACAGGTGGAGCAAGG + Intergenic
1001468147 5:171987123-171987145 GTTTTTCCACAGACCAGGCACGG - Intronic
1001538138 5:172514131-172514153 ATTTTTCCACAGCCAGAGTTGGG - Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1002195643 5:177499559-177499581 ATTTTTCCACAGACTGGGGGTGG - Intergenic
1003948456 6:11096178-11096200 ATTTTTCCACAGACGGAGCAGGG + Intronic
1004373756 6:15074599-15074621 ATTTTTCCACAGATGGAGGGTGG + Intergenic
1004949762 6:20655696-20655718 ATTTTTCCACAGACCGGGGGTGG - Intronic
1005283288 6:24298053-24298075 ATTTCTCCACAGACGGAGTGGGG + Intronic
1005527498 6:26665321-26665343 AATTTTCCACAGATGGTGGAGGG - Intergenic
1008694139 6:54014414-54014436 ATTTTTCCACAGATGGGGCTAGG + Intronic
1008967487 6:57327851-57327873 ATTTTTCCACGGACTGAGGTCGG + Intronic
1009526101 6:64748344-64748366 ATTTTTCCACAGACAGGGTGAGG + Intronic
1011569914 6:88724546-88724568 ATTTTTCCACAGACAGGGGAAGG + Intronic
1011752623 6:90468560-90468582 ATTTTTCCACATATGGGGTATGG - Intergenic
1011894170 6:92203031-92203053 ATTTTTCCACAGACCAGGTAGGG - Intergenic
1012291244 6:97458301-97458323 ATTTTTCCAAAAACAGAGCCGGG + Intergenic
1013333649 6:109133219-109133241 GTTTTTCCACAGATGCGGCAGGG + Intronic
1013465818 6:110416038-110416060 ATTTTTCCACAGACTGGGGATGG + Intergenic
1013501046 6:110751610-110751632 GTTTTTCCACAGACCCAGCAGGG - Intronic
1014010436 6:116469413-116469435 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1014102794 6:117530285-117530307 GTTTTTCCACAGACGGGGTGGGG + Intronic
1014527590 6:122519456-122519478 ATTTTTCCACAGACGGAGGTGGG - Intronic
1014744995 6:125190486-125190508 GTTTTTCCACAGACGAAGGTTGG + Intronic
1014747504 6:125217209-125217231 ATTTTTCCACAGACAAAGGGTGG + Intronic
1015135767 6:129868222-129868244 ATTTTTCCCCAGTTGGAGCCTGG - Intergenic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1015508508 6:134014116-134014138 ATTTTTCCACAGACGGGGGCAGG + Intronic
1015553885 6:134440919-134440941 ATTTTTCCACAGATGGGACTGGG - Intergenic
1015812422 6:137174123-137174145 AGTTTTCCAGAGAGGGAGAAGGG - Intergenic
1016704700 6:147093210-147093232 ATATTTCAACAGGCCGAGCACGG + Intergenic
1017097299 6:150815929-150815951 ATTTTTCCACGGATGGAGGCAGG + Intronic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1017260106 6:152376021-152376043 ATTTTTCCACAGATGGGGTGGGG + Intronic
1019498296 7:1351706-1351728 CGTTTTCCACAGACGGTGCTGGG - Intergenic
1020151693 7:5686778-5686800 ATTTTTCCACGGACAGGGCGTGG + Intronic
1020780264 7:12509057-12509079 ACTTTTCCACAGACTGAGGAAGG - Intergenic
1021710218 7:23408950-23408972 ATTTTTCCACGGACAGAGAGTGG + Intronic
1022746646 7:33179737-33179759 ATTTTTCCACAGACCAGGAAGGG - Intronic
1022833223 7:34088860-34088882 ATTGTTCCACAGATGCATCAGGG - Intronic
1023199700 7:37682992-37683014 ATTTTTCCACAGACAGGGGTGGG - Intergenic
1023337296 7:39183644-39183666 ATTTTTCCACAGACCAAAGAGGG - Intronic
1023728770 7:43170358-43170380 ATTTTTCCACAGACAGGGGTGGG - Intronic
1023783699 7:43684127-43684149 TTTTTTCCACAGAGGAGGCAGGG + Intronic
1024650838 7:51402125-51402147 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1024761554 7:52602929-52602951 ATTTTTCCACCGACCAAGGAGGG - Intergenic
1025054959 7:55757705-55757727 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1025133030 7:56387927-56387949 ATTTTTCCACAGACTGGGAGTGG + Intergenic
1027494760 7:78873700-78873722 ACTTTTCCACAGACAGGGCAAGG - Intronic
1027747000 7:82088832-82088854 ATTTTTCCACAAATGGAGGTGGG + Intronic
1028057198 7:86261173-86261195 ATTTTTCCACGGACGGGGAAGGG + Intergenic
1028297148 7:89148002-89148024 ATTTTTCCACAGACAGGGCAAGG - Intronic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1029236852 7:99127256-99127278 CTTTTTGCACATACGGATCAGGG - Intronic
1029264152 7:99325439-99325461 GGCTTTCCACAGAGGGAGCACGG + Intergenic
1030258014 7:107532411-107532433 ACTTTTCCATAGACATAGCAAGG + Intronic
1030613824 7:111717145-111717167 ATTTTTCCATAGACAGGGTAGGG - Intergenic
1030625046 7:111835764-111835786 ATTTTTCAACAGAAGCAGCTGGG + Intronic
1031221820 7:118976319-118976341 ATTTTTCCACGGACGGGGAGGGG + Intergenic
1031240768 7:119236546-119236568 CTTTTTCCAGAGATGGAGGAAGG - Intergenic
1032073395 7:128823833-128823855 ATTTTTCCACAGATGGAGAGGGG + Intergenic
1035774094 8:2173959-2173981 ATTTTTCCACGGACGGGGTGAGG + Intergenic
1035813017 8:2508139-2508161 ATTTTTCCATGGACAGGGCATGG - Intergenic
1036578596 8:10052378-10052400 TTTTTTCCACAGATGGGGAAGGG - Intergenic
1037190404 8:16117952-16117974 ATTTTTCCACAGACCAGGGATGG - Intronic
1038032973 8:23661091-23661113 ATTTTTCCACAGATGGTGGGGGG + Intergenic
1038607659 8:29024969-29024991 ATTTTTCCACCGACGGGGTGGGG - Intronic
1039187328 8:34931822-34931844 ATTTTTCTACAGAAGGGGCGGGG + Intergenic
1039392267 8:37190857-37190879 ACTTTTCCACTTACGGAGCCTGG - Intergenic
1039586041 8:38707930-38707952 ATTTTTACACAGAAGGCGGAGGG - Intergenic
1040763086 8:50874305-50874327 ATTTTTCCACTGCTGGAGCTGGG + Intergenic
1040907451 8:52483280-52483302 ATTTTTCCACAGACCAAGGGTGG + Intergenic
1041281569 8:56215427-56215449 ATTTTTCCACGGATGGGGAAGGG + Intronic
1041351226 8:56949910-56949932 ATTTTTCCACAGACTAAGGCAGG - Intergenic
1041835661 8:62210428-62210450 ATTTTTCCACAGAGTGGGGATGG - Intergenic
1042378250 8:68081127-68081149 ATTTTTCCACAGGCGGAGGGTGG + Intronic
1043005579 8:74814352-74814374 ATTTTTCCACAGACGAGGGAGGG + Intronic
1043866829 8:85384163-85384185 ATTTTTCCACAGACCGACGTGGG - Intronic
1045229783 8:100292963-100292985 ATTTTTCCACAGATGGAGGTGGG + Intronic
1045364627 8:101464316-101464338 GTTTTTCAACAGACGGTGCAGGG + Intergenic
1045877531 8:106999736-106999758 ATTTTTCCACAGACAGGGTGGGG - Intergenic
1048583441 8:135750138-135750160 ATTTTTCCACAGATGGTGGAAGG - Intergenic
1049255767 8:141612844-141612866 ATTTTTCCACGGACGGGGTAGGG + Intergenic
1050399622 9:5238265-5238287 ATATTTACAGAGACAGAGCATGG + Intergenic
1051689606 9:19696237-19696259 GTTTTTCCACAGACCGAGGTTGG - Intronic
1052189490 9:25642079-25642101 ATTTTTCCACAAATGGGGGATGG + Intergenic
1052597749 9:30582300-30582322 ATTTTTCCACACACAGAGGGTGG + Intergenic
1052811403 9:33063794-33063816 ATTTTTCCACAGATGGTGGTGGG - Intronic
1052955842 9:34252730-34252752 CTTGGTCCACAGACGGAGCTGGG - Exonic
1052990299 9:34515043-34515065 ATTTTTCCTTAGATGGAGCCGGG - Intronic
1053136896 9:35656738-35656760 ATTTTTCCATGGACGAAGCGGGG - Intergenic
1054699946 9:68403445-68403467 ATTTTTCCACAGACTGGGGGAGG - Intronic
1055354957 9:75428295-75428317 ATTTTTCCACAGACTGGGAGGGG - Intergenic
1055767882 9:79684599-79684621 ATTTTTCCATGGACGGAGGTGGG - Intronic
1056706451 9:88956088-88956110 ATTTTTCCACGGAGGGTGCGTGG + Intergenic
1058981084 9:110171306-110171328 CCTTATCCACACACGGAGCATGG - Exonic
1059348040 9:113645585-113645607 ATTTTTCCACAGACAGGAGATGG - Intergenic
1059870701 9:118570929-118570951 ATTTTTGCAGAGATGGAGCCTGG - Intergenic
1060345958 9:122815998-122816020 ATTTTTCCACAGACTGGGGTTGG + Intronic
1060460172 9:123845276-123845298 ACTTTTCAACAGAAGGTGCAGGG + Intronic
1060543853 9:124449292-124449314 ATTTTTGTACAGACAGAGCAGGG + Intergenic
1061177763 9:129007945-129007967 ACTCTTCCACAGAGTGAGCAGGG - Intronic
1061467589 9:130794143-130794165 ATTTTTCCACAGACTGGGGATGG - Intronic
1061527860 9:131182548-131182570 TTTTTTCCACAGACGGACAGCGG - Intronic
1061581177 9:131537431-131537453 ACTTTTCCACAGACTGGGTAGGG + Intergenic
1061844220 9:133377730-133377752 ATTTTTCCACAGATGGAGGCGGG + Intronic
1186050215 X:5584474-5584496 ATTTTTCCACAGACAGGGGTGGG + Intergenic
1186996709 X:15131400-15131422 TTTTTTCCACAGACGGGGGGTGG - Intergenic
1187386251 X:18851368-18851390 ATTTTTCCACAGACTGGGGTCGG - Intergenic
1187473496 X:19589629-19589651 TTTATGCCACACACGGAGCAAGG - Intronic
1189642099 X:43084407-43084429 ATTTTTCCACAGACCAGGGACGG + Intergenic
1190027221 X:46935673-46935695 AATTTTCCACGGACGGGGGAAGG - Intronic
1190552024 X:51593772-51593794 ATTTTTAGACTGAAGGAGCATGG - Intergenic
1190951561 X:55150285-55150307 ATTTTTCCACAGATGGGGGAAGG + Intronic
1192084480 X:68082666-68082688 GTTGTTCCACATATGGAGCATGG + Intronic
1192142056 X:68654255-68654277 ATTTTGCCACAGAACGAGTAGGG - Intronic
1192156313 X:68749171-68749193 ATTTTTCCACAGATGAGGCCTGG - Intergenic
1193224270 X:78963479-78963501 ATTTCTCCACAGACATAGCAGGG - Intergenic
1193324410 X:80162594-80162616 ATTTCTCCACAGATGGAGTGGGG - Intergenic
1195639980 X:107162801-107162823 ATTTTTCCACAGATGGCGGGAGG + Intronic
1195768866 X:108327326-108327348 ATTTTTCCATAGAAGGGGCCGGG - Intronic
1197840874 X:130745037-130745059 ATTTTTCCACAGACTGAGTCGGG - Intronic
1200254182 X:154570664-154570686 AGTTTTCCACAGACGGGGATGGG + Intergenic
1200263587 X:154633744-154633766 AGTTTTCCACAGACGGGGATGGG - Intergenic
1201241862 Y:11965119-11965141 ATTTTTCCACAGACAGGGTTGGG + Intergenic
1201326472 Y:12765687-12765709 ATTTTTCCACAGACTGGGTGGGG - Intronic
1201332262 Y:12837291-12837313 TTTTTTTCACAGACTGAGGATGG + Intronic
1201943977 Y:19490761-19490783 ATTTTTCCACAGACAGAGGAGGG + Intergenic