ID: 1003950131

View in Genome Browser
Species Human (GRCh38)
Location 6:11109045-11109067
Sequence TCCCCAGGTCAACCCCAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 2, 1: 0, 2: 1, 3: 11, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003950131_1003950137 -2 Left 1003950131 6:11109045-11109067 CCCAATTGGGGTTGACCTGGGGA 0: 2
1: 0
2: 1
3: 11
4: 104
Right 1003950137 6:11109066-11109088 GAACTATGGTGGCCCCCACAGGG No data
1003950131_1003950142 15 Left 1003950131 6:11109045-11109067 CCCAATTGGGGTTGACCTGGGGA 0: 2
1: 0
2: 1
3: 11
4: 104
Right 1003950142 6:11109083-11109105 ACAGGGTAGCCACCAGTGTCAGG No data
1003950131_1003950136 -3 Left 1003950131 6:11109045-11109067 CCCAATTGGGGTTGACCTGGGGA 0: 2
1: 0
2: 1
3: 11
4: 104
Right 1003950136 6:11109065-11109087 GGAACTATGGTGGCCCCCACAGG 0: 1
1: 0
2: 2
3: 3
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003950131 Original CRISPR TCCCCAGGTCAACCCCAATT GGG (reversed) Intronic
901237844 1:7677028-7677050 TCCCCAGCTCAACACCCACTGGG + Intronic
911482041 1:98455661-98455683 TCCCAAAGTCAGCTCCAATTGGG + Intergenic
917666259 1:177228657-177228679 TCCCCTCGTCAGCACCAATTCGG - Intronic
920063393 1:203245643-203245665 TCCCTAGATAATCCCCAATTTGG - Intronic
1071902672 10:90137664-90137686 TCCCCTTGACAACCCTAATTGGG + Intergenic
1075853801 10:125610352-125610374 TCCCAGGCTGAACCCCAATTTGG + Intronic
1077047926 11:554475-554497 TCCCCAGGCCAAACCCAGTTGGG - Exonic
1081322920 11:41713243-41713265 TCCCAAGGGCAACCCCCATTTGG - Intergenic
1084876898 11:72139741-72139763 AGCCCAGGGCAACCCCAATGAGG + Exonic
1084879431 11:72159613-72159635 GGCCCAGGGCAACCCCAATGAGG + Intergenic
1084884700 11:72196051-72196073 AGCCCAGGGCAACCCCAATGAGG + Exonic
1087094705 11:94307578-94307600 TGCTCAGGGCAACCCCAATGTGG + Intronic
1087965059 11:104402906-104402928 TCCCCAGGTCAACAGAAATCTGG - Intergenic
1090999940 11:131901976-131901998 TGCCCATGTCAACCCCAGGTTGG + Intronic
1092713502 12:11363698-11363720 TCCACAGTACAACCCTAATTTGG - Intronic
1094500992 12:31020643-31020665 TCCCCAGGGTAACCCCCACTTGG - Intergenic
1095991534 12:48037835-48037857 TCCCCAGGTCATCCCCAGAGAGG + Intergenic
1097249864 12:57626575-57626597 TCACCAGGACAACCCCTACTGGG + Exonic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1110167460 13:72460452-72460474 TCCCCAAGTCAGCCCCAAGTTGG - Intergenic
1115336401 14:32247475-32247497 TCCCCAGGTCAACCCCAATTGGG - Intergenic
1115956996 14:38792372-38792394 TCCACAGGGCAACCCCAAGGAGG + Intergenic
1121973272 14:98379008-98379030 TTCCCAGGTCAACAGCAATGTGG - Intergenic
1124998590 15:34748014-34748036 TGCCCAGGACAGACCCAATTTGG + Intergenic
1126310365 15:47309190-47309212 TCCCCATGTCAATCACCATTTGG + Intronic
1128682187 15:69660199-69660221 TCCCCATGGCCACCCCAATCTGG - Intergenic
1129204051 15:74024909-74024931 TCACCAGGTCAACGTCAATAGGG - Exonic
1130361741 15:83193997-83194019 TCCCAAGCTAAGCCCCAATTTGG + Intronic
1131686295 15:94771730-94771752 TCCCCATCTCTAGCCCAATTTGG + Intergenic
1132079355 15:98851604-98851626 TCCCCAGGTGCTGCCCAATTTGG + Intronic
1132863832 16:2084156-2084178 CCTCCAGGTCAACCCCAGGTGGG + Intronic
1136689402 16:32018140-32018162 TCCTCTGCTAAACCCCAATTTGG + Intergenic
1136789994 16:32961682-32961704 TCCTCTGCTAAACCCCAATTTGG + Intergenic
1136879818 16:33892254-33892276 TCCTCTGCTAAACCCCAATTTGG - Intergenic
1137917642 16:52450382-52450404 TCCCAAATTCAACCCCAACTGGG + Exonic
1139037525 16:62965696-62965718 TCCCAGGCTCAGCCCCAATTTGG - Intergenic
1141664452 16:85458644-85458666 TTCCCAGGACAACCCCACTTTGG - Intergenic
1142175528 16:88643373-88643395 TCCCCAGGTCAACCCCATCCCGG - Exonic
1203092197 16_KI270728v1_random:1223145-1223167 TCCTCTGCTAAACCCCAATTTGG + Intergenic
1144035749 17:11364067-11364089 TCCCCAGCTAAACCCCAATTTGG + Intronic
1146091267 17:29880877-29880899 TCCCCAGGTCTAGCCCTAATTGG - Intronic
1147152249 17:38524285-38524307 TCCTCTGCTAAACCCCAATTTGG + Intergenic
1148227400 17:45908564-45908586 TCCCCATGTCTACACCAATGTGG + Intronic
1148783466 17:50134195-50134217 TCCCCACTTTAACCCCAAATTGG - Exonic
1148786849 17:50149784-50149806 TCCCCAGGTCAACTCGAAGCTGG - Exonic
1148958647 17:51374671-51374693 TCCCCAGGTCCTCCTCAATAAGG + Intergenic
1150834427 17:68551822-68551844 TTCCCAGGGCCACCCCAACTGGG + Intronic
1153637259 18:7123309-7123331 TGCCCAGGTGAAACCCATTTTGG + Intergenic
1153757375 18:8298042-8298064 TCCCCAGGACAAACCCAACCGGG + Intronic
1159517531 18:69476645-69476667 TCTCAAGGTCAACTCCAATGAGG - Intronic
1159912427 18:74159041-74159063 TGCCCAGGTCTACCCAACTTGGG - Exonic
1161347912 19:3777318-3777340 TCCCCAGGCCATCCCTAAATGGG + Intergenic
1165285085 19:34834995-34835017 TCCCAAGCTAAGCCCCAATTTGG + Intergenic
1166385642 19:42379047-42379069 TCCTCAGGGAAACCCCAGTTTGG + Intergenic
1167108920 19:47447534-47447556 TCCCGAGGCCAAGCCCACTTTGG + Intronic
926384589 2:12323691-12323713 TCCCCAGTGTAACCCCAATTTGG + Intergenic
926607730 2:14914346-14914368 TCCCAAGGGCAACCCCCATGTGG - Intergenic
926975761 2:18515265-18515287 TCCCCAGGCCAACCCTGATGGGG + Intergenic
927061334 2:19425121-19425143 TCACCTGGTCAACCCCTAGTTGG - Intergenic
927190673 2:20514810-20514832 TCCCCAGACTGACCCCAATTGGG - Intergenic
936656852 2:114498566-114498588 TCCCCAGGCCAACCCGATATGGG - Intronic
937621133 2:123987877-123987899 TCCCTGGGTAAACCCCATTTAGG - Intergenic
939277798 2:140023243-140023265 TCCCCATCTGAACCCAAATTGGG - Intergenic
940197663 2:151113828-151113850 TCCCAGGCTGAACCCCAATTTGG + Intergenic
946383243 2:219363955-219363977 TCCCCAGGCCAGCCCCAAAGGGG - Intergenic
1170523583 20:17213921-17213943 TCTCCAGGCCAAGCCCAGTTAGG + Intergenic
1173935683 20:46860826-46860848 TTCCCAAGTCAATCCCCATTAGG + Intergenic
1174079470 20:47960807-47960829 TCCCCATGTGAACCCCAAGGGGG + Intergenic
1179214155 21:39351492-39351514 TCCCCACCTCAACCCCAACCAGG - Intergenic
1181382400 22:22516835-22516857 TCCCCAGATTAACCCCATCTGGG + Intronic
1182029624 22:27147686-27147708 TCGCAAGCTAAACCCCAATTTGG + Intergenic
1182735134 22:32527959-32527981 TCCCCAGGGCAAGCCCAGCTGGG - Exonic
950072077 3:10160803-10160825 TCCCAGGCTAAACCCCAATTTGG - Intergenic
950452778 3:13074538-13074560 TCCTCAAGACAACCCCAATGAGG + Intergenic
950964367 3:17136164-17136186 TCCCTAGGTCTACACCATTTGGG - Intergenic
952944720 3:38471361-38471383 TCACCAGGTGAACCCCAGGTGGG + Intronic
953798256 3:46001904-46001926 TCCCTAGGTTGACCCTAATTCGG + Intergenic
962657879 3:137567276-137567298 TCTCCAGTTCAACACCAATAAGG - Intergenic
971555841 4:28012556-28012578 CCCCCAAGTCAGCCCCAATGGGG - Intergenic
974029701 4:56765153-56765175 TCTCCAGGTAAACCTCAATAAGG + Intergenic
977097158 4:92760622-92760644 TCTCAGGGTCAACACCAATTTGG - Intronic
983942438 4:173549365-173549387 TCCCCGGGCCATCCCCAAGTTGG - Intergenic
984469911 4:180155241-180155263 ACCCCAGGTCTACCCCATGTAGG - Intergenic
985838320 5:2287357-2287379 ACAACAGGTCAACCCCAATGGGG + Intergenic
986789190 5:11143985-11144007 TCCCCAGGTCTACACCAGCTAGG + Intronic
990776733 5:59312401-59312423 TCCCCAGCTGGACCCCAATCAGG + Intronic
999655435 5:153806165-153806187 TGCCCATGTCATCACCAATTTGG - Intronic
1000646487 5:163766186-163766208 TCCCCAGCTAAGCCCCAATTTGG - Intergenic
1001382283 5:171312465-171312487 TCCCCAGGTCAAATCCACCTGGG + Intergenic
1003950131 6:11109045-11109067 TCCCCAGGTCAACCCCAATTGGG - Intronic
1005114357 6:22319065-22319087 GCCCCAGGGCATCCCCAAATTGG - Intergenic
1017999854 6:159569475-159569497 TCCCCAGGTCAATCACACTTAGG + Intergenic
1023090060 7:36609071-36609093 GCCCAAGGTCAACCCCAACCCGG + Intronic
1024211144 7:47206276-47206298 TTCCTGGGACAACCCCAATTTGG - Intergenic
1024787895 7:52929517-52929539 TTCCCATGCCAACCCCACTTGGG + Intergenic
1029102960 7:98149149-98149171 TCCTCAGGACAACCCCAGTTAGG + Intronic
1037260581 8:17002586-17002608 TCCCAAGGACAACCCCAAAGAGG - Intergenic
1038188000 8:25293079-25293101 ACCCCAGGCCACCACCAATTTGG - Intronic
1039890591 8:41682965-41682987 TCCCCAGGTCCACCCCCTTGGGG - Intronic
1040302412 8:46194909-46194931 CCCCCAGGTCCATCCCAAATGGG + Intergenic
1043522771 8:81064099-81064121 TCCCCAAGTCAACCCCGGTGTGG - Intronic
1047006273 8:120623543-120623565 TCCCTAGTGCAACCCCAATGTGG + Intronic
1049355590 8:142186656-142186678 TCCCCAGGCCAGCCCTACTTAGG + Intergenic
1049571326 8:143371565-143371587 TCCCCAGGTCAGCCCCACTCTGG + Intronic
1050836431 9:10085746-10085768 TCCCCAGGTGAAACACAAGTAGG + Intronic
1051172268 9:14330695-14330717 TCCTCAGGTCTACCTCCATTTGG - Intronic
1051587227 9:18739706-18739728 TCCCCACGTCAACACCCTTTAGG + Intronic
1051889113 9:21925068-21925090 TCACTGGGTCAGCCCCAATTGGG + Intronic
1060877412 9:127093375-127093397 TCCCCATGGAAACCCCACTTGGG + Intronic
1062301425 9:135874024-135874046 TCCCCAGGACAAACACAAATTGG - Intronic
1187033294 X:15510541-15510563 TCCCCTGGTTTCCCCCAATTGGG - Intronic
1187064329 X:15818580-15818602 TCCCTAGGTCAGCTGCAATTTGG + Exonic
1187539291 X:20175780-20175802 TCCCCTGTTCCACCCCAACTAGG - Intronic
1191608031 X:63082732-63082754 TCCCCCGGTTGACCCCAATTAGG + Intergenic
1193286822 X:79723749-79723771 TCCCCAGGTTGATCCCAACTGGG + Intergenic
1195296297 X:103481388-103481410 TCCACATGGTAACCCCAATTGGG - Intergenic
1196314323 X:114204820-114204842 TCCCCAGCTGAGCCCTAATTTGG + Intergenic
1200493760 Y:3857169-3857191 TCCCCAGGTCGATGCCAACTAGG - Intergenic