ID: 1003952428

View in Genome Browser
Species Human (GRCh38)
Location 6:11128459-11128481
Sequence AAGCAGTACAGCTCACAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003952428_1003952433 -8 Left 1003952428 6:11128459-11128481 CCGACCTGTGAGCTGTACTGCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1003952433 6:11128474-11128496 TACTGCTTGTAGTTGAGGAGGGG No data
1003952428_1003952436 25 Left 1003952428 6:11128459-11128481 CCGACCTGTGAGCTGTACTGCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1003952436 6:11128507-11128529 ATTCCTTTGGTTGCCCCAGGTGG No data
1003952428_1003952434 12 Left 1003952428 6:11128459-11128481 CCGACCTGTGAGCTGTACTGCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1003952434 6:11128494-11128516 GGGTAATGCAAGCATTCCTTTGG No data
1003952428_1003952435 22 Left 1003952428 6:11128459-11128481 CCGACCTGTGAGCTGTACTGCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1003952435 6:11128504-11128526 AGCATTCCTTTGGTTGCCCCAGG 0: 1
1: 0
2: 3
3: 14
4: 114
1003952428_1003952431 -10 Left 1003952428 6:11128459-11128481 CCGACCTGTGAGCTGTACTGCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1003952431 6:11128472-11128494 TGTACTGCTTGTAGTTGAGGAGG 0: 1
1: 0
2: 1
3: 13
4: 130
1003952428_1003952432 -9 Left 1003952428 6:11128459-11128481 CCGACCTGTGAGCTGTACTGCTT 0: 1
1: 0
2: 1
3: 11
4: 125
Right 1003952432 6:11128473-11128495 GTACTGCTTGTAGTTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003952428 Original CRISPR AAGCAGTACAGCTCACAGGT CGG (reversed) Intronic
902110638 1:14075502-14075524 AAGCAGTACAGATAAGGGGTTGG + Intergenic
902899255 1:19502778-19502800 AAGGAATTCAGCTCACAGGAGGG + Intergenic
905524531 1:38626096-38626118 AGGCAGTACAGGTCACAAGTGGG + Intergenic
906163120 1:43665777-43665799 AAGGAGCACAGCTCATAGGAGGG - Intronic
908033403 1:60026109-60026131 AACCAGTTCAGTTCTCAGGTTGG + Intronic
908231515 1:62110207-62110229 AAGAAATACAGCTCTCAGTTTGG + Intronic
909721518 1:78776336-78776358 GACTAGAACAGCTCACAGGTTGG + Intergenic
912633316 1:111267953-111267975 AGGCAGTGCAGCTCAAAGCTCGG - Intergenic
917330046 1:173871131-173871153 AAGCAGTGAAGTTGACAGGTAGG + Exonic
917783091 1:178420603-178420625 TCGCAGTACAGATGACAGGTAGG + Exonic
918669172 1:187192496-187192518 AAGAAGTACAGCTAGCAGGAAGG + Intergenic
918674731 1:187269073-187269095 TAACAGTACAGATCACTGGTTGG - Intergenic
920459482 1:206128340-206128362 AAACAGTCAAGCTCACAAGTTGG - Intergenic
923052320 1:230397229-230397251 AAGCAGTACAGCTTGCAAGGTGG - Intronic
923263096 1:232285987-232286009 AAGCTATACAGCTCACATCTGGG - Intergenic
924384621 1:243489752-243489774 AAGCATTACAGCTGGCAAGTAGG + Intronic
1065370062 10:24975217-24975239 AAACAGCACAGCTCAAGGGTGGG + Intergenic
1071723359 10:88169762-88169784 AAGCAGTACAGCTCTCAAGTCGG + Intergenic
1073186918 10:101620547-101620569 AAGCAGCAGAGCCCACAGGCTGG + Intronic
1075534772 10:123261565-123261587 ATTAAGTACAGCTCGCAGGTTGG + Intergenic
1076509295 10:131000656-131000678 AAGAAGTAAAGCTGAGAGGTTGG + Intergenic
1083380165 11:62260914-62260936 ATGGAGTACAGCTCACTGGGTGG + Intergenic
1086324592 11:85685585-85685607 AAGTATTACAGCTCACAGTCCGG - Exonic
1090770526 11:129915655-129915677 AAGCAGTACAGCAGCAAGGTAGG - Exonic
1091234136 11:134008457-134008479 AAGCAGAGCAGCTCACTGATGGG - Intergenic
1091251826 11:134150512-134150534 ATCCAGCACAGCTCTCAGGTGGG + Exonic
1091670505 12:2448889-2448911 AACCAGTAGATCTCACAAGTAGG - Intronic
1092359014 12:7820459-7820481 TAGCATCAGAGCTCACAGGTTGG - Intronic
1097590378 12:61567287-61567309 AGGCAGGACAACTCAAAGGTGGG - Intergenic
1098588485 12:72184058-72184080 AAGCAGTACAACACAAATGTAGG + Intronic
1100987522 12:100217565-100217587 CAGCACTACAGCTCACAGATTGG + Intronic
1102114526 12:110392697-110392719 AAGTAGTAAAGCTCACAAATTGG + Intronic
1103356823 12:120327715-120327737 TAGCTGTGCTGCTCACAGGTAGG - Exonic
1108613729 13:52109819-52109841 AAGCAGGACAACTCAAAGCTGGG - Intronic
1115149854 14:30271871-30271893 AAGCAATACAGCTAATATGTCGG + Intergenic
1117507844 14:56420253-56420275 AAGCAGAACAGCTTAAAGCTAGG - Intergenic
1118740149 14:68733568-68733590 AAACAGGCCAACTCACAGGTGGG + Intergenic
1119382346 14:74237308-74237330 AAGGAGTCCAGCTCCCAGGGTGG + Intergenic
1120479627 14:85033860-85033882 AAGCAGTGCAGAGCAAAGGTGGG - Intergenic
1125482778 15:40092005-40092027 TATCAGTACAGCTCACAGCGGGG + Intronic
1127875161 15:63105821-63105843 AAGCAGTAAAGTTCAGAGCTGGG + Intergenic
1128138554 15:65282542-65282564 CAGCAAGACTGCTCACAGGTGGG - Intronic
1132177138 15:99724847-99724869 AAGGGGTACAGGTCACAGGTTGG + Intronic
1136657440 16:31718605-31718627 CAGTAACACAGCTCACAGGTAGG - Intronic
1136673740 16:31880381-31880403 CAGTAACACAGCTCACAGGTAGG - Intronic
1147618854 17:41849030-41849052 AAACAGAACAGCTCATAGTTGGG - Intergenic
1155666271 18:28312930-28312952 AAGCAGTAATGCCCACAGTTAGG - Intergenic
1156109380 18:33705779-33705801 AAGCTGTACAGCTATCAGGTGGG - Intronic
1156820074 18:41361643-41361665 AAGCAATTCTGTTCACAGGTGGG + Intergenic
1157031360 18:43912320-43912342 AAGAAGTCCAGATGACAGGTTGG - Intergenic
1157100403 18:44724091-44724113 AAGTGGCACAGCTCACATGTTGG + Intronic
1159990936 18:74906402-74906424 GAGCAGCACAGCTGACAGTTGGG - Intronic
1160605154 18:80044652-80044674 AAGCAGTAAACATCACAGATGGG + Intronic
1160989665 19:1855399-1855421 AGGCAGGAAAGCTCACAGGGAGG + Intronic
1163435876 19:17294705-17294727 AAGCAGTGCAGGACGCAGGTGGG + Exonic
1168256272 19:55167064-55167086 ACACAGAACAGCCCACAGGTGGG + Intergenic
925116171 2:1379940-1379962 GAGCAGTATAGTTCACAGTTTGG + Intronic
925948850 2:8892683-8892705 AAGGAATACAGAACACAGGTGGG + Intronic
927452864 2:23223874-23223896 ATGCAGTACAACTCACAGCAGGG + Intergenic
935676661 2:105600335-105600357 AAGCAGCACAGCGGACCGGTCGG + Intergenic
936551681 2:113448310-113448332 AAGCAGTAGATCTCAATGGTGGG + Intronic
937299665 2:120831497-120831519 AAGCAGGACAGCTCACACCCAGG + Intronic
938579245 2:132631493-132631515 AATCAGTAAAGCTCTCAGGAAGG - Intronic
942464419 2:176192461-176192483 TAGCAGTAGAGCTCAGAGGGGGG - Intergenic
945692179 2:213050783-213050805 AAGCAGTACAACTGGCAAGTAGG + Intronic
948367377 2:237465938-237465960 AAGCAATGCAGCACACAGGAGGG + Intergenic
1173190117 20:40869705-40869727 AAGCAGGCCTGCTCACAGGCCGG + Intergenic
1180135132 21:45857571-45857593 AGGCAGGACAGCTCAAAGGTGGG - Intronic
1182698186 22:32210228-32210250 ATTCAGTTCAGCTCACAGCTGGG - Intergenic
1182726365 22:32449285-32449307 AAGAAGTGCTACTCACAGGTAGG + Intronic
1182786212 22:32909840-32909862 AAGCAGTGCAGTTCCCGGGTCGG + Intronic
1184301387 22:43562861-43562883 AGGCAGCCCAGGTCACAGGTGGG + Intronic
949318295 3:2781670-2781692 AGGCAGGACAGCTCAAAGGTGGG + Intronic
951063318 3:18235573-18235595 AAGCAGAACAGCTACCAGCTAGG - Intronic
951129195 3:19021805-19021827 AAGCAGAAGAGCTTTCAGGTGGG - Intergenic
951377905 3:21944621-21944643 AAGCAGTTCAGCTGAAGGGTGGG + Intronic
953422307 3:42763980-42764002 AAGCAGGACAACTCCAAGGTTGG + Intronic
955143172 3:56289749-56289771 ATGCTGTACAGCTTAAAGGTAGG - Intronic
955193014 3:56779349-56779371 AAACAGGACTGGTCACAGGTTGG + Intronic
955909832 3:63848439-63848461 AAGCAGGACAGCTTGAAGGTGGG - Exonic
958954360 3:100451323-100451345 AGGCAGGACAACTCAAAGGTGGG + Intronic
963046989 3:141109814-141109836 AAGCAGGGCAGGTCACAGGCTGG + Intronic
963486848 3:145945386-145945408 AAGCAGTACAAATCATAGATAGG - Intergenic
964612444 3:158628498-158628520 AAGCAGGACAGCTCAAAGCAGGG + Intergenic
966170796 3:177078005-177078027 AATCTATACACCTCACAGGTGGG + Intronic
969556111 4:7911347-7911369 GGTCAGTACAGCTCACAGTTTGG - Intronic
969943607 4:10760145-10760167 AAGCAGGACAGTTCAGAGTTGGG - Intergenic
972867500 4:43252106-43252128 TGGCAGTACAGTTCACAGATTGG + Intergenic
974973212 4:68856847-68856869 AAGCAGTAGATCTCAAAAGTGGG - Intergenic
975080965 4:70280296-70280318 AGGCAGTACAGCTCAAAGCAAGG + Intergenic
975402147 4:73950801-73950823 AAGTTAGACAGCTCACAGGTTGG + Intergenic
975728897 4:77318963-77318985 TAGCGCTACAACTCACAGGTGGG - Intronic
977741795 4:100493010-100493032 AAGAAGTACAGCTAACATCTGGG + Intronic
981002385 4:139840249-139840271 AAGCAGCACAGTTCATAAGTGGG + Intronic
981022015 4:140039304-140039326 GAGCAGTCCAGCAGACAGGTTGG - Intronic
981312218 4:143308436-143308458 AGGCAGGACAACTCAAAGGTGGG + Intergenic
981439280 4:144764528-144764550 AAGCAGTAGATCTCAAAAGTGGG + Intergenic
984677595 4:182568144-182568166 ACGCAGTACAGCTTGAAGGTAGG - Intronic
985012753 4:185600881-185600903 AAACAGTCCAGCCCACAGGTTGG - Intronic
986724293 5:10582646-10582668 AGGCAGCACAGCGCACAGCTGGG - Intronic
989837330 5:46008957-46008979 AAGGAGAACAACCCACAGGTGGG - Intergenic
993162109 5:84305547-84305569 AAGCAGGAGAACTCACAGCTTGG - Intronic
995339461 5:111041521-111041543 AAGCAGTACATCTCAATAGTGGG + Intergenic
997212034 5:132082535-132082557 AGGCAGAACAGCTCACAGCATGG + Intergenic
998725614 5:145010059-145010081 AACCAGTATGGCTAACAGGTAGG - Intergenic
999668832 5:153940581-153940603 AGGCAGGACAACTCAGAGGTAGG - Intergenic
1003952428 6:11128459-11128481 AAGCAGTACAGCTCACAGGTCGG - Intronic
1007957903 6:45933888-45933910 GAGGAGCACAGCTCACAGGTGGG + Intronic
1008724099 6:54394869-54394891 AAGATGCACAGTTCACAGGTAGG + Intergenic
1009942064 6:70301758-70301780 AGGCACTGCAGCTCACAGATTGG + Intronic
1014216710 6:118758817-118758839 AGGCAGTACACCACACAGGAGGG - Intergenic
1014839711 6:126204332-126204354 AAGCAATGTAGCTCACAGATGGG - Intergenic
1015738950 6:136432638-136432660 ATGAAGTGCAACTCACAGGTTGG + Intronic
1020497223 7:8871047-8871069 AAGAAGCACGGCTGACAGGTGGG + Intergenic
1021324783 7:19253520-19253542 CTGCAGCACAGCTCAAAGGTAGG - Intergenic
1022411157 7:30139664-30139686 ATGCAGAACAGCCCACAGGTGGG + Intronic
1026569783 7:71519431-71519453 ATGCAGTAGAGCTCAGAGATTGG - Intronic
1028284666 7:88981436-88981458 AGGCAGTGTAGCTCACAGCTCGG - Intronic
1028973753 7:96889426-96889448 AAGAAGTTCAGCTAACAGGTTGG + Intergenic
1028993499 7:97075525-97075547 TTGCAGTTCAGCTCACAGGAAGG - Intergenic
1030654267 7:112148999-112149021 AAGCAGTAGAGCTTGCAGGAGGG - Intronic
1036226164 8:6959558-6959580 CAGCAGTGCTGCTCACAGGCAGG + Intergenic
1036234754 8:7028887-7028909 CAGCAGTGCTGCTCACAGGCAGG + Intergenic
1042499045 8:69489057-69489079 AAGCAGGGGAGCTCACAGTTAGG + Intronic
1045940182 8:107729220-107729242 CAGCAGTAAAACTCATAGGTGGG - Intergenic
1047089729 8:121560423-121560445 AAGAAGTATGACTCACAGGTTGG + Intergenic
1049844581 8:144793617-144793639 AAGCAGCACAGCCCACAGCTAGG + Intergenic
1049901316 9:168842-168864 AAGCAGTAGATCTCAATGGTGGG - Intronic
1050020534 9:1279965-1279987 CATCAGTACAGTTCACAGCTGGG + Intergenic
1051689095 9:19690359-19690381 AAGCCCTACAGCCCAGAGGTGGG - Intronic
1053744356 9:41179153-41179175 AAGCAGTAGATCTCAATGGTGGG - Intronic
1054349630 9:64009078-64009100 AAGCAGTAGATCTCAATGGTGGG - Intergenic
1054482913 9:65686042-65686064 AAGCAGTAGATCTCAATGGTGGG + Intronic
1054683989 9:68252097-68252119 AAGCAGTAGATCTCAATGGTGGG + Intronic
1055405816 9:75972808-75972830 AAGCTGTACAGTTGAAAGGTGGG - Intronic
1186120850 X:6359481-6359503 AAACAATTCAGCTCACAGATGGG - Intergenic
1187308955 X:18122520-18122542 AAGTAGTCCAGCTCACCGGCTGG - Intergenic
1197077315 X:122367573-122367595 AAGAAAAACAGCTCACAGGGAGG + Intergenic