ID: 1003954333

View in Genome Browser
Species Human (GRCh38)
Location 6:11147979-11148001
Sequence TGCACCATCGCTGCAGTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003954333_1003954340 27 Left 1003954333 6:11147979-11148001 CCCTGCACTGCAGCGATGGTGCA No data
Right 1003954340 6:11148029-11148051 ATGTTCCCACCCGTGCTTGAGGG No data
1003954333_1003954341 28 Left 1003954333 6:11147979-11148001 CCCTGCACTGCAGCGATGGTGCA No data
Right 1003954341 6:11148030-11148052 TGTTCCCACCCGTGCTTGAGGGG No data
1003954333_1003954342 29 Left 1003954333 6:11147979-11148001 CCCTGCACTGCAGCGATGGTGCA No data
Right 1003954342 6:11148031-11148053 GTTCCCACCCGTGCTTGAGGGGG No data
1003954333_1003954339 26 Left 1003954333 6:11147979-11148001 CCCTGCACTGCAGCGATGGTGCA No data
Right 1003954339 6:11148028-11148050 TATGTTCCCACCCGTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003954333 Original CRISPR TGCACCATCGCTGCAGTGCA GGG (reversed) Intergenic
No off target data available for this crispr