ID: 1003954334

View in Genome Browser
Species Human (GRCh38)
Location 6:11147980-11148002
Sequence TTGCACCATCGCTGCAGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003954334_1003954339 25 Left 1003954334 6:11147980-11148002 CCTGCACTGCAGCGATGGTGCAA No data
Right 1003954339 6:11148028-11148050 TATGTTCCCACCCGTGCTTGAGG No data
1003954334_1003954341 27 Left 1003954334 6:11147980-11148002 CCTGCACTGCAGCGATGGTGCAA No data
Right 1003954341 6:11148030-11148052 TGTTCCCACCCGTGCTTGAGGGG No data
1003954334_1003954342 28 Left 1003954334 6:11147980-11148002 CCTGCACTGCAGCGATGGTGCAA No data
Right 1003954342 6:11148031-11148053 GTTCCCACCCGTGCTTGAGGGGG No data
1003954334_1003954340 26 Left 1003954334 6:11147980-11148002 CCTGCACTGCAGCGATGGTGCAA No data
Right 1003954340 6:11148029-11148051 ATGTTCCCACCCGTGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003954334 Original CRISPR TTGCACCATCGCTGCAGTGC AGG (reversed) Intergenic
No off target data available for this crispr