ID: 1003954335

View in Genome Browser
Species Human (GRCh38)
Location 6:11148011-11148033
Sequence AACATATGGCTGTAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003954335_1003954339 -6 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954339 6:11148028-11148050 TATGTTCCCACCCGTGCTTGAGG No data
1003954335_1003954347 17 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954347 6:11148051-11148073 GGGTAGCAGCTCATAGCCCCAGG No data
1003954335_1003954348 20 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954348 6:11148054-11148076 TAGCAGCTCATAGCCCCAGGAGG No data
1003954335_1003954342 -3 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954342 6:11148031-11148053 GTTCCCACCCGTGCTTGAGGGGG No data
1003954335_1003954341 -4 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954341 6:11148030-11148052 TGTTCCCACCCGTGCTTGAGGGG No data
1003954335_1003954340 -5 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954340 6:11148029-11148051 ATGTTCCCACCCGTGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003954335 Original CRISPR AACATATGGCTGTAGGGACA AGG (reversed) Intergenic
No off target data available for this crispr