ID: 1003954339

View in Genome Browser
Species Human (GRCh38)
Location 6:11148028-11148050
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003954334_1003954339 25 Left 1003954334 6:11147980-11148002 CCTGCACTGCAGCGATGGTGCAA No data
Right 1003954339 6:11148028-11148050 TATGTTCCCACCCGTGCTTGAGG No data
1003954333_1003954339 26 Left 1003954333 6:11147979-11148001 CCCTGCACTGCAGCGATGGTGCA No data
Right 1003954339 6:11148028-11148050 TATGTTCCCACCCGTGCTTGAGG No data
1003954331_1003954339 30 Left 1003954331 6:11147975-11147997 CCTTCCCTGCACTGCAGCGATGG No data
Right 1003954339 6:11148028-11148050 TATGTTCCCACCCGTGCTTGAGG No data
1003954335_1003954339 -6 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954339 6:11148028-11148050 TATGTTCCCACCCGTGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003954339 Original CRISPR TATGTTCCCACCCGTGCTTG AGG Intergenic