ID: 1003954340

View in Genome Browser
Species Human (GRCh38)
Location 6:11148029-11148051
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003954333_1003954340 27 Left 1003954333 6:11147979-11148001 CCCTGCACTGCAGCGATGGTGCA No data
Right 1003954340 6:11148029-11148051 ATGTTCCCACCCGTGCTTGAGGG No data
1003954335_1003954340 -5 Left 1003954335 6:11148011-11148033 CCTTGTCCCTACAGCCATATGTT No data
Right 1003954340 6:11148029-11148051 ATGTTCCCACCCGTGCTTGAGGG No data
1003954334_1003954340 26 Left 1003954334 6:11147980-11148002 CCTGCACTGCAGCGATGGTGCAA No data
Right 1003954340 6:11148029-11148051 ATGTTCCCACCCGTGCTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003954340 Original CRISPR ATGTTCCCACCCGTGCTTGA GGG Intergenic
No off target data available for this crispr