ID: 1003957345

View in Genome Browser
Species Human (GRCh38)
Location 6:11176027-11176049
Sequence AGTTATACACACCTGGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003957345_1003957351 24 Left 1003957345 6:11176027-11176049 CCACCCACCAGGTGTGTATAACT No data
Right 1003957351 6:11176074-11176096 ATTTTGAATGTCAGAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003957345 Original CRISPR AGTTATACACACCTGGTGGG TGG (reversed) Intergenic
No off target data available for this crispr