ID: 1003957672

View in Genome Browser
Species Human (GRCh38)
Location 6:11179254-11179276
Sequence CACCTCCAAATGCTGTTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003957672_1003957680 19 Left 1003957672 6:11179254-11179276 CCTTGCAACAGCATTTGGAGGTG No data
Right 1003957680 6:11179296-11179318 GAGAGCTCCACCCTCATGCATGG No data
1003957672_1003957682 26 Left 1003957672 6:11179254-11179276 CCTTGCAACAGCATTTGGAGGTG No data
Right 1003957682 6:11179303-11179325 CCACCCTCATGCATGGTTAATGG No data
1003957672_1003957684 28 Left 1003957672 6:11179254-11179276 CCTTGCAACAGCATTTGGAGGTG No data
Right 1003957684 6:11179305-11179327 ACCCTCATGCATGGTTAATGGGG No data
1003957672_1003957683 27 Left 1003957672 6:11179254-11179276 CCTTGCAACAGCATTTGGAGGTG No data
Right 1003957683 6:11179304-11179326 CACCCTCATGCATGGTTAATGGG No data
1003957672_1003957678 -3 Left 1003957672 6:11179254-11179276 CCTTGCAACAGCATTTGGAGGTG No data
Right 1003957678 6:11179274-11179296 GTGGGGCCTAATGGGAAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003957672 Original CRISPR CACCTCCAAATGCTGTTGCA AGG (reversed) Intergenic
No off target data available for this crispr