ID: 1003958344

View in Genome Browser
Species Human (GRCh38)
Location 6:11186914-11186936
Sequence TAGAAAAGTAAAGCTGTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 395
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003958344_1003958345 8 Left 1003958344 6:11186914-11186936 CCTTCAACAGCTTTACTTTTCTA 0: 1
1: 0
2: 1
3: 30
4: 363
Right 1003958345 6:11186945-11186967 TTTCTTCTTAGCGATTGCTATGG 0: 1
1: 0
2: 2
3: 19
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003958344 Original CRISPR TAGAAAAGTAAAGCTGTTGA AGG (reversed) Intronic
900319193 1:2074197-2074219 TAGAAAAATAAGGCTGTGGAGGG + Intronic
904510789 1:31005489-31005511 TAAAAAAATAAAGCTGATGCTGG - Intronic
904670051 1:32157680-32157702 TAAAAAGATAAAACTGTTGAAGG - Intronic
904949997 1:34229360-34229382 CAGAAAAGTAAAGCAGGTTAAGG + Intergenic
906226039 1:44122223-44122245 AAGAAAAGGGAAGCTGTTGCAGG - Intronic
907975685 1:59429197-59429219 TAGCAAAGTAAATCTCTTGGTGG + Intronic
908877312 1:68692114-68692136 TAGAAAAGGAAGGCTGCTGGAGG - Intergenic
910117301 1:83746193-83746215 GAGAAAAGTAGAGCAATTGATGG - Intergenic
910123228 1:83813352-83813374 TAGAAAAATAACGCTGATTAAGG + Intergenic
910528174 1:88205026-88205048 AAGAAATATAAAGCTTTTGAAGG + Intergenic
911472557 1:98336180-98336202 TAGAAAATTAAATCTGTAGCTGG - Intergenic
914747965 1:150513205-150513227 GAGAAAAGTAAAACAGATGATGG - Intronic
915203169 1:154248972-154248994 AATAAAAGTAAAGCTGTAGGAGG - Intronic
915414084 1:155726586-155726608 TAGGAAAGTAAAGCTGAGGCCGG - Intronic
916044237 1:160986996-160987018 GAGAAAAGGAATTCTGTTGATGG + Intergenic
916287140 1:163120623-163120645 AAGAAAGGAAAGGCTGTTGATGG + Intronic
916295283 1:163212439-163212461 TAGAAAAGAAAGGCTCTTCAAGG + Intronic
916662018 1:166931328-166931350 AAGCTAAGTAAAGCTGTTTATGG + Intronic
917214246 1:172661455-172661477 TAGAAAAGTAAAGCCTCTGGAGG + Intronic
917596009 1:176529760-176529782 TAAAAAAAAAAAGCTGGTGATGG - Intronic
918670324 1:187206993-187207015 TGGAAAAGTAAAACTAATGATGG + Intergenic
918780592 1:188694953-188694975 TAGAACAGTAAAAATGCTGAGGG + Intergenic
918911671 1:190580548-190580570 CTGAAAAGTAAAGAGGTTGATGG + Intergenic
919694706 1:200562613-200562635 TAGAAAAGGAAGCTTGTTGAAGG - Intronic
919698012 1:200599097-200599119 TTGAAAACAGAAGCTGTTGACGG - Intronic
920019132 1:202940644-202940666 TAAAAAAGTAAAGCTGTATTGGG + Intergenic
921500960 1:215902589-215902611 TAGAAAAATAAAGCAGTGTAAGG + Intronic
921576858 1:216845423-216845445 TAGAAAAACAAAGCTGGTCATGG + Intronic
921764439 1:218953557-218953579 AAGAAAATTAAAGTTGGTGATGG + Intergenic
921978988 1:221234559-221234581 TAGAAAAGATAAGCAGTTGAGGG + Intergenic
922023959 1:221733370-221733392 TAGAAAAGCAAAGCAGGGGAAGG - Intronic
922628765 1:227082384-227082406 AAGAAAAATAAAGGTGTTGCAGG - Intronic
924121258 1:240800723-240800745 TATAAAAATAAATGTGTTGAAGG + Intronic
924356555 1:243183068-243183090 TTTAAAAATAAAGCTGTTGGAGG - Intronic
1063716867 10:8536230-8536252 TAGGAAAGACAAGCTGTTGGGGG - Intergenic
1064502617 10:15990807-15990829 TAGAAAAACAAAGCTGTTGGTGG - Intergenic
1070618581 10:77988644-77988666 ATGAAAAATAAAGCTGTAGAGGG + Intronic
1071278939 10:84081890-84081912 AAGAAAAGAAAAGCTGATGCTGG + Intergenic
1072547834 10:96454192-96454214 GAGGAAAGAAAAGCTTTTGAGGG + Intronic
1075373789 10:121961350-121961372 TACATAAGAAAAGCTGTAGAAGG - Intronic
1075568840 10:123524126-123524148 AATAAAAATAATGCTGTTGATGG - Intergenic
1076414082 10:130272631-130272653 TAAAAAAGACAAGCTCTTGAGGG - Intergenic
1077805479 11:5587754-5587776 TGAAATGGTAAAGCTGTTGAAGG - Intronic
1077973653 11:7223199-7223221 TTAAAAAGTAAAGATGTTCAAGG + Intergenic
1078269936 11:9785852-9785874 AAAAAAAATAAAGATGTTGATGG + Intronic
1078837812 11:15048619-15048641 TGGAAAAGTAAACCTCATGATGG - Intronic
1079572665 11:21964063-21964085 TAGGAAAGCAATTCTGTTGAGGG + Intergenic
1080902186 11:36505634-36505656 TAGAAAGGAAAAGTTTTTGAAGG - Intronic
1081087200 11:38815809-38815831 GAGAAAAGAATAACTGTTGAGGG - Intergenic
1081098310 11:38968906-38968928 TAGAACAGAAAGGCTGTTGTTGG - Intergenic
1082912068 11:58388800-58388822 CAGAAGTGTAAAGCTGTTAAAGG - Intergenic
1083568932 11:63745392-63745414 AAGAAAAATAAAGCTGTTAAAGG + Intronic
1084369589 11:68731619-68731641 AAGAAATGGAAAGCTATTGATGG + Intronic
1084771680 11:71346935-71346957 CAGAAAAGTAAATCAGTGGAAGG + Intergenic
1085229439 11:74952053-74952075 AAGTAGAGGAAAGCTGTTGAAGG + Intronic
1086019706 11:82212368-82212390 TAGAAAAGTGAATTCGTTGAAGG - Intergenic
1086414739 11:86577253-86577275 CAGAAAAGCAAAGCTGAGGAGGG + Intronic
1087448724 11:98289753-98289775 TAGTAAAGCAAAACTCTTGAGGG - Intergenic
1087504828 11:99006124-99006146 TAGAAAATAAGAGCTTTTGATGG + Intergenic
1087733851 11:101809605-101809627 TAGAAAGTTAAAGCTGGTGTAGG + Intronic
1088060208 11:105639256-105639278 TAGAAAGATAAAGTTGGTGAAGG + Intronic
1088603646 11:111508076-111508098 ACGAAAAGTAGAGGTGTTGAGGG - Intronic
1089469349 11:118708358-118708380 TAGAAAAGAAATGCTGTTAGAGG - Intergenic
1089501007 11:118931071-118931093 GAGAAAAGTAAGGCAATTGAAGG - Intronic
1090017559 11:123099776-123099798 GGGAAAAGTGAAGCAGTTGATGG + Intronic
1091433798 12:458417-458439 TAGAAAAGAAAATGTGTTGGAGG + Intergenic
1092003480 12:5049814-5049836 TAGAAGAGAAAAGCTGCTGCAGG + Intergenic
1092610593 12:10168232-10168254 TAGAAAAGAGAAGATATTGAGGG - Intronic
1093962581 12:25291454-25291476 TGGAAAAGTAAATCTCCTGAGGG - Intergenic
1095801164 12:46270517-46270539 GACAAAAGTAAAGCAGATGAGGG - Intergenic
1095830415 12:46579869-46579891 TATAAAAGTATAGCAATTGAAGG + Intergenic
1096068111 12:48757198-48757220 GAGAAAAGGAAAGCTGTTTAGGG - Intergenic
1098075536 12:66726394-66726416 TAGATAAGGAAAGCAATTGAAGG - Intronic
1099109523 12:78540044-78540066 TTCAAAAGTAAAGCTTTTGTGGG + Intergenic
1099307736 12:80979198-80979220 TAGAATAGTAAAGCTGTACCAGG - Intronic
1099622196 12:85017345-85017367 TATAAAAATAATGTTGTTGACGG - Intronic
1099829356 12:87820720-87820742 AAGAAAAGGGAAGCTGTTGCAGG - Intergenic
1100627898 12:96355344-96355366 GAGAAAATTAAAGCAGTTAAGGG - Intronic
1100975380 12:100116910-100116932 TATAAAAATAAATCAGTTGAAGG + Intronic
1101542570 12:105678176-105678198 TAGAAAATTAAAGCTGACTAAGG - Intergenic
1101883948 12:108645410-108645432 TAATGAAGTAAAGTTGTTGATGG - Exonic
1104410367 12:128552750-128552772 TACAAAAATTAAGCTGTTCATGG + Intronic
1105301548 13:19139967-19139989 AAGAGAAGTAAGGCAGTTGAAGG - Intergenic
1105543228 13:21332795-21332817 TAAAAAAGGAAATCTGCTGATGG + Intergenic
1107691126 13:42954497-42954519 CAGATACTTAAAGCTGTTGAGGG + Intronic
1108227041 13:48300665-48300687 CAGAAAACTAAAGATTTTGATGG + Intergenic
1108403253 13:50071168-50071190 TAGAAAAGAAAAGCTGGCTATGG - Intergenic
1110379010 13:74828141-74828163 TATAAAAGAAAAGTTCTTGAAGG + Intergenic
1110495360 13:76161738-76161760 CAGTGTAGTAAAGCTGTTGAAGG - Intergenic
1111552439 13:89832350-89832372 TAGAAAAGTAAATGAGGTGAAGG + Intergenic
1111724577 13:91990033-91990055 GAGAAAAGAAATGCTGTTTATGG - Intronic
1111974297 13:94949735-94949757 TAGAAAAGAAAAGAAGTTTAGGG + Intergenic
1112203404 13:97300680-97300702 TAGTGGAGTAAAGATGTTGAAGG - Intronic
1112988187 13:105478213-105478235 TAGAAAAGTACATCTGTATAAGG - Intronic
1113160272 13:107372110-107372132 CAGAACAGGAAAGGTGTTGAAGG + Intronic
1113242185 13:108350263-108350285 GAGAAAAGTAAAAGTGCTGAAGG + Intergenic
1113554989 13:111226013-111226035 TACAAATGAAAAGCTCTTGAAGG + Intronic
1114470037 14:22954366-22954388 TAGAAAATGCAAGCTCTTGAAGG + Intronic
1114593329 14:23890177-23890199 TAGAAGAGTAAAGCTCTTGTGGG - Intergenic
1114714265 14:24807875-24807897 CAGCAAATTAAAGCTGTCGAGGG - Intergenic
1116029048 14:39549120-39549142 AAGAAAAGAAATGCTGTTTATGG - Intergenic
1118411754 14:65486881-65486903 TAGAAAAGTAAAGCTTTCTCTGG - Intronic
1118757844 14:68858176-68858198 TAGAGAATTAAAGCTGCTTAAGG + Intergenic
1118955149 14:70474520-70474542 TTGAAAAGTTTAGTTGTTGAAGG - Intergenic
1119577955 14:75744998-75745020 TAGAAAAATAATGATGTTGAGGG + Intronic
1120267815 14:82274053-82274075 TAGAAAAATTAGACTGTTGAGGG - Intergenic
1121200714 14:92115123-92115145 TTAAAAAGTTAAGTTGTTGAAGG + Intergenic
1123954430 15:25320149-25320171 TAGAAAAGTGAATCTCTTGCCGG + Intergenic
1124169113 15:27356527-27356549 TGCAAAGGAAAAGCTGTTGATGG + Intronic
1124839397 15:33227909-33227931 TAGCAAAGTAATGCAGGTGAAGG + Intergenic
1125179167 15:36861911-36861933 TAGAAATCTATAGATGTTGATGG + Intergenic
1125671425 15:41476115-41476137 TAGAAAAGGAAAACTCTTGAAGG - Intronic
1125737921 15:41941505-41941527 TATAAAAGTATAGATGTTTATGG - Intronic
1126905745 15:53362802-53362824 TAGAAAAATAAATCTGTTCTGGG - Intergenic
1127425812 15:58855148-58855170 AATAAAGGTAAAGCTGTTTAAGG - Exonic
1128092604 15:64929114-64929136 GAGAAAAACAAAGCTGTTGAGGG + Intronic
1128175646 15:65553404-65553426 TAGAGCAGTAAATCTGCTGAGGG - Intronic
1128209563 15:65885901-65885923 GAGAAAAGGAATTCTGTTGAGGG + Intronic
1129069827 15:72941471-72941493 TAGGCAAATAAAGCTTTTGATGG - Intergenic
1131575716 15:93588645-93588667 TAGAAAAGTAAAACTATTCTTGG + Intergenic
1131713749 15:95085516-95085538 TAGAAAGGTAAATCTGCTGAGGG + Intergenic
1131768603 15:95709363-95709385 TACAAAAGAAAAACTGTTGATGG - Intergenic
1131935615 15:97501063-97501085 TAGAAAAATGAAGCTCTAGAAGG + Intergenic
1133824513 16:9265829-9265851 AAGAAAAGTCCAGTTGTTGATGG + Intergenic
1137469783 16:48743881-48743903 GAAAAAAGTAAAGCTATTGCAGG + Intergenic
1137756129 16:50903862-50903884 TAGAAGTGTAAAGGTGTTGGGGG - Intergenic
1137772219 16:51025506-51025528 CAGAGAAGTAAAACTGGTGAGGG + Intergenic
1138223080 16:55269554-55269576 TAGATAAGTAAATGTGTAGATGG - Intergenic
1140869895 16:79096616-79096638 GAGAAAAATAAAGCAGGTGAAGG - Intronic
1141417265 16:83885538-83885560 CAGAATAGTAAAGCTGCAGAAGG + Intergenic
1143353904 17:6310277-6310299 AAGAAAAGTAAAGAAGTTGAAGG - Intergenic
1143765923 17:9137799-9137821 AAAAAAAATAAAACTGTTGACGG + Intronic
1143819539 17:9548643-9548665 AAGAATAGGAAAGCTGTTTAGGG + Intronic
1144024821 17:11268611-11268633 GAGAAAAGTAAAGCCGGAGATGG - Intronic
1147020616 17:37529554-37529576 AAGAAAAGAAAAGGTGTGGAGGG + Intronic
1147689979 17:42309040-42309062 TTGACAGCTAAAGCTGTTGATGG + Exonic
1147789124 17:43002129-43002151 TAGAAAAATAAAGTAGTTGTGGG + Intronic
1148641715 17:49192782-49192804 CAGAAAAATAAATGTGTTGATGG + Intergenic
1149047843 17:52268430-52268452 TAGAAACACAAAGATGTTGAGGG + Intergenic
1150916829 17:69445865-69445887 TGGAAAAGTAAAGCTTGTGCAGG + Intronic
1153623700 18:7003963-7003985 TTGAAAAGTAAAAGTGTTAATGG + Intronic
1154409218 18:14127489-14127511 GAGAGAAGAAAAGGTGTTGAAGG - Intronic
1155046599 18:22108787-22108809 TTTAAAAGAAAAGCTGTTCAAGG - Intergenic
1155288658 18:24318835-24318857 TAGTACATTTAAGCTGTTGATGG - Intronic
1156920456 18:42516285-42516307 AAGAAAAGAAAAGGTCTTGAGGG - Intergenic
1158210113 18:55039637-55039659 TAGGAAAGTGAAGGTGTGGATGG + Intergenic
1158847500 18:61459986-61460008 TTGAAAAGAAAAGCTCTTGTTGG + Intronic
1159388847 18:67761694-67761716 TGCAAAAGTAAAGTTATTGAAGG + Intergenic
1159716131 18:71825696-71825718 TAAAAAAGAAAAGATCTTGAGGG - Intergenic
1163066329 19:14798958-14798980 TAGAAAAGAAATGATTTTGAGGG + Intronic
1166273898 19:41737633-41737655 TAGCAAAGTACAACTGTGGAAGG - Intronic
1166589589 19:43984929-43984951 TAGAAAAGTCAGGCTGGGGAAGG - Intronic
1166624365 19:44336656-44336678 GAGAGAAGAAAAGCTTTTGATGG - Exonic
1166673987 19:44728053-44728075 GAGAAAAATAAAACTGGTGAGGG - Intergenic
1168564245 19:57410028-57410050 CAGAAAAGTAAAGCTGAATAGGG - Intronic
926775739 2:16420772-16420794 TAGAAAACTAAAGATGATTAGGG + Intergenic
929288136 2:40159167-40159189 GAGGAAAGCAAAGCTGTGGAAGG - Intronic
929730027 2:44478993-44479015 TAGAAAAGAAAAGCAATTGCCGG - Intronic
931591181 2:63885096-63885118 AAGAAAGGTAAAGCTGGTGATGG - Intronic
932067630 2:68583266-68583288 TAGGGTAGTAAAGCTGTTGCAGG - Intronic
932584660 2:73020206-73020228 TAGAAAAGGAAATCCTTTGAAGG + Intronic
934713040 2:96527902-96527924 GGGAAAAGTAAAACTCTTGAGGG + Intergenic
935521540 2:104111887-104111909 TTGAAAAGTAAAGAAGTTGGAGG - Intergenic
935762945 2:106338230-106338252 TAGAAAGGTAATGCTATTTAGGG + Intergenic
936241971 2:110795676-110795698 CAGAAAAGCCAAGCTGCTGAGGG - Intronic
936619241 2:114077702-114077724 TAGAATACTAAAGCTGTAAACGG - Intergenic
937825356 2:126363230-126363252 TAGAAGAGAAAAGCAGTGGAAGG - Intergenic
938158648 2:128962868-128962890 TGGAAAGGAAAAGCTGTTGAAGG + Intergenic
938796765 2:134724253-134724275 TAAAAAAGGAAAGCTGAGGAAGG + Intergenic
938997016 2:136690728-136690750 TACAACAGTAAAACTGTTGAAGG + Intergenic
939517542 2:143188030-143188052 CAAAAAAACAAAGCTGTTGAAGG - Intronic
939729946 2:145771448-145771470 TAGACAAGGAAAGTTGGTGATGG - Intergenic
940880328 2:158940477-158940499 TAGAAAGGAAAAGTTCTTGAAGG + Intergenic
941496662 2:166213698-166213720 AAGAAAATTACAGCTTTTGAAGG + Intronic
942766199 2:179460167-179460189 AAGAAAAATAAAGCTGGTCATGG + Intronic
942807581 2:179950842-179950864 TATAGAAGTAAAGAAGTTGATGG + Exonic
945775144 2:214097618-214097640 TAGGAAAGGACAGCTGGTGAAGG + Intronic
945808443 2:214518623-214518645 TAGAAAAATCCTGCTGTTGAAGG - Intronic
946308370 2:218869051-218869073 TAGATAAGTAAAGCAATGGAGGG - Intronic
946529197 2:220553231-220553253 AAGAAAAAAAAATCTGTTGATGG - Intergenic
947624123 2:231608868-231608890 AACAAAAGTGAAGCTGATGACGG + Intergenic
947683238 2:232055998-232056020 TAGAACAGTAAAGCTTTTCAAGG + Intronic
1169856114 20:10104996-10105018 TAGAATATTAAAGCTGATAAGGG - Intergenic
1171147122 20:22794725-22794747 TAGAAAAGAGAAGCTGATTATGG + Intergenic
1172335027 20:34108651-34108673 TAGAAAATTTATGCTTTTGAAGG - Intronic
1173013271 20:39201533-39201555 TTTAAAAGAAAAACTGTTGAAGG - Intergenic
1173886776 20:46466015-46466037 TAGGAAACTAGAGGTGTTGATGG + Intergenic
1175317807 20:58063645-58063667 TAGAAAAATATAGGTGTTCATGG + Intergenic
1176742632 21:10618106-10618128 CAATAAAATAAAGCTGTTGAAGG - Intergenic
1176864003 21:14032400-14032422 GAGAGAAGAAAAGGTGTTGAAGG + Intergenic
1177167601 21:17620089-17620111 TACAAAAGAAAAGTTCTTGAAGG - Intergenic
1177785075 21:25663017-25663039 AAGAAAAGTAAAGCTTTCGCTGG - Intronic
1177937947 21:27373037-27373059 GCGAAATGGAAAGCTGTTGAAGG + Intergenic
1179011137 21:37557227-37557249 AGGAAAAGTAAAGCAGGTGAGGG - Intergenic
1181888475 22:26040540-26040562 GAGGAAAATAAAGCTGTAGAAGG + Intergenic
1184938863 22:47746140-47746162 TAGAGAAGCAAAGATGATGATGG - Intergenic
1185031872 22:48448281-48448303 TAAGAAAGTAAGGCTGTTGTTGG - Intergenic
949178756 3:1100978-1101000 TAGAAAACAACATCTGTTGAAGG - Intronic
949499616 3:4667181-4667203 TAGAAAAGTAAAGGATGTGAAGG + Intronic
949780592 3:7682518-7682540 TACAAAAATAAAGCTGTTATTGG - Intronic
950011555 3:9727719-9727741 TAGAATTGGAAAGCTCTTGAAGG + Intronic
950093239 3:10312157-10312179 TAAAACAGTAAATCTGTGGAAGG - Intronic
950122193 3:10489219-10489241 GAGAAAAATAAAGCAGATGAAGG - Intronic
951719456 3:25682532-25682554 GAGAAAAATAAAACTGTTGCAGG - Intergenic
951915989 3:27801311-27801333 TAGAATAGTGAAGATGATGATGG + Intergenic
952744708 3:36765487-36765509 GAGAAAAGGCAAGATGTTGAAGG - Intergenic
955694888 3:61625891-61625913 TAGAAAAGGAAAGCAGCTGTAGG - Intronic
956160924 3:66351812-66351834 TAGAACAGTGAACTTGTTGATGG - Intronic
956420550 3:69082210-69082232 AAGTAAAATAAATCTGTTGAAGG - Intergenic
956959829 3:74386275-74386297 TACAAAATGAAAGCTGTAGAGGG - Intronic
957945748 3:87060260-87060282 AAGAAAAGTAAAGCAGTGTAAGG + Intergenic
958672795 3:97226700-97226722 TAGGAAATTATAGCAGTTGAAGG + Intronic
959746723 3:109783932-109783954 AAGCAAAGGAAAGCTCTTGAAGG + Intergenic
959775545 3:110157317-110157339 TCCAAAAGGAAAGCTATTGAAGG - Intergenic
959784334 3:110276165-110276187 TAGAAAGGAAAAGTTCTTGAAGG + Intergenic
959896890 3:111616162-111616184 AAAAAAAGTAAATCTGATGAGGG + Intronic
960384359 3:117003293-117003315 TGGAAAAGTAAAGATGAGGATGG - Intronic
960395709 3:117134661-117134683 TAGAAAATTACAGCTGTTTCTGG + Intronic
960484940 3:118240053-118240075 TAGCAAGGTAAAGCTATTGTGGG - Intergenic
960815491 3:121667737-121667759 TTTAAAAGCAAAGCTGTAGAGGG + Intronic
964169243 3:153749156-153749178 TAGAAATGATAAGCTGTAGAAGG + Intergenic
966310726 3:178590799-178590821 TATAAAAGTAGAGTTGTGGAGGG - Intronic
966597094 3:181733870-181733892 TCTAAAACTAAAGCTGTTGGAGG - Intergenic
967463340 3:189773713-189773735 TAGAAAAAAAAAGCCATTGATGG - Intronic
968985073 4:3870537-3870559 TAAAATATTAAAGCTGTTGATGG + Intergenic
969288601 4:6223907-6223929 GAGAAAAGTTAAACTGTTAAAGG - Intergenic
969832612 4:9809832-9809854 AAGAAAAGAAAACTTGTTGATGG - Intronic
970467389 4:16338924-16338946 AAGAACAATAAAGCTCTTGAAGG - Intergenic
970987192 4:22172357-22172379 TAGAAAAGTAAAGTGGTTATGGG + Intergenic
971278908 4:25224933-25224955 TAGAAAATTTAAACTGTTGGAGG + Intronic
972028089 4:34412557-34412579 GAGAAAAGTAAAGAAGGTGAGGG + Intergenic
973056783 4:45669357-45669379 TAGAAAGCTAAAGATGTTGAAGG - Intergenic
973242301 4:47969983-47970005 TAGATAAGTAATACTTTTGAAGG + Intronic
974095227 4:57356236-57356258 GAGAAAAGCAAAGCTGATAAGGG + Intergenic
974431146 4:61797721-61797743 TAGAAAAGAAAATATGTTGTTGG - Intronic
975854196 4:78605939-78605961 TAGAAAAGTAAATCAATGGAAGG - Intronic
978057794 4:104294360-104294382 TAAGAAAGTAAAGGTGGTGAGGG - Intergenic
978182966 4:105823726-105823748 AAGAAAAGCAAAGCATTTGATGG - Intronic
978260513 4:106751997-106752019 TACAAAAGAAAAGCTCTTAAAGG - Intergenic
978289895 4:107125394-107125416 AAGAAATGTAAAGATGTTGCTGG - Intronic
979245262 4:118496537-118496559 TTTAAAAATAAAGCTGTTGGAGG + Intergenic
979820458 4:125163381-125163403 TAGCAAAGAAAAGTTGTAGATGG - Intergenic
979839369 4:125419085-125419107 AGGAATAGTAAAGTTGTTGAAGG - Intronic
980873018 4:138631819-138631841 TTGGATAGTAAATCTGTTGAGGG + Intergenic
983016085 4:162614557-162614579 TAAAAAAAAAAAGCAGTTGAAGG + Intergenic
983325242 4:166246041-166246063 AAGAAAAATAAAGAGGTTGATGG + Intergenic
983994313 4:174162891-174162913 TAGAAATGTTTTGCTGTTGAAGG + Intergenic
985017964 4:185657249-185657271 CAGAGAAAGAAAGCTGTTGATGG - Intronic
985239848 4:187918581-187918603 AAGAAAAGTAAAGCTGGGTAAGG + Intergenic
986440880 5:7780700-7780722 CAGAAATGTAAAGTTTTTGAAGG + Intronic
987418956 5:17695578-17695600 TAGAAAACAAGAGCTATTGATGG + Intergenic
987921037 5:24282338-24282360 GAGAAAAGTAAAGCAGATAAAGG + Intergenic
987957307 5:24756819-24756841 AAGAAAAAAAAAGATGTTGATGG - Intergenic
988353880 5:30147589-30147611 GACAAAAGTAAAGCTTTTGTAGG + Intergenic
989249944 5:39300997-39301019 CAAAATAATAAAGCTGTTGAAGG + Intronic
990286538 5:54305824-54305846 TTGAAAAGTAAAACCGTGGATGG + Intronic
990563322 5:57004901-57004923 TAGTTAAGGAAAGCTGTTGGTGG - Intergenic
990756034 5:59071652-59071674 TAAAAAAGTACAGATGTTGCAGG - Intronic
991322152 5:65385979-65386001 GAGAAAAGATAAGCTGTTCACGG + Intronic
992835973 5:80641803-80641825 TACAAAAGAAAAGCTCTTGAAGG + Intronic
993632094 5:90299050-90299072 ATGAAAAGAAAAGCTGTTCAGGG + Intergenic
995285889 5:110387887-110387909 TCCAAGAGTAAAGCTGGTGATGG - Intronic
996277609 5:121686495-121686517 TAGAAAAGAAATGCTTTTGGGGG - Intergenic
996547141 5:124691987-124692009 AAGAAAAGTAAAAATGTAGATGG - Intronic
996747992 5:126862416-126862438 AAGAAGAGTAAAGTTGTTAAGGG + Intergenic
998004054 5:138645636-138645658 AAGAAAAAAAAAGCTGTTAAAGG - Intronic
999035556 5:148344992-148345014 TAGAAAAGTAATTCCCTTGAGGG - Intergenic
999862697 5:155665701-155665723 GAGAACAGTAATGATGTTGAAGG + Intergenic
1001370545 5:171196137-171196159 AAGAAAAGTAAAGCAGGTTATGG + Intronic
1002148986 5:177211049-177211071 GAGAAAAGTAATGGTTTTGATGG - Exonic
1002412097 5:179089076-179089098 TAGTAAAGTATTGCTCTTGAGGG + Intergenic
1003958344 6:11186914-11186936 TAGAAAAGTAAAGCTGTTGAAGG - Intronic
1004047746 6:12042630-12042652 TAGAATAGAAAACATGTTGACGG - Intronic
1004104833 6:12657244-12657266 GATAAAAGTAAGGCTGTTGTGGG - Intergenic
1004282320 6:14291238-14291260 CAAAATTGTAAAGCTGTTGATGG - Intergenic
1004987089 6:21094657-21094679 CATAAAAGTAAAGATGTTTATGG + Intronic
1005313736 6:24584700-24584722 TAGAAAAGCAAAGTTGTCCAAGG + Intronic
1005743392 6:28813953-28813975 TAGAAGAGTACAGCCCTTGAAGG - Intergenic
1006227450 6:32551608-32551630 AAGAAACGTAAAGCTGCTGCAGG + Intergenic
1007139812 6:39560525-39560547 TAGAAAAGCAAAGCTGGACAGGG - Intronic
1007624147 6:43233440-43233462 TAGAAGAGTAAAAGTGTAGAAGG + Intergenic
1007663695 6:43502163-43502185 TAGAAAACTGAAGTTCTTGAGGG + Intronic
1008109853 6:47479868-47479890 TAGAAAAGGAAAGATGATGGGGG - Intronic
1008196911 6:48535777-48535799 TAGGAAAGTAAAGGTGGTTAAGG - Intergenic
1008253440 6:49268602-49268624 TAGGAAAGTAAAGATGAAGATGG + Intergenic
1008855743 6:56084764-56084786 TAAAAAAGTAAAGATATTAAAGG + Intronic
1009086884 6:58854378-58854400 TAGAAAAGGAAACATGTTCATGG + Intergenic
1009102249 6:59068284-59068306 TAGAAAAGGAAACATGTTCATGG + Intergenic
1009112742 6:59214436-59214458 TAGAAAAGGAAACATGTTCATGG + Intergenic
1009118886 6:59299824-59299846 TAGAAAAGGAAACATGTTCATGG + Intergenic
1009526998 6:64760191-64760213 TGGAAAAGTACAGATGCTGATGG - Intronic
1010070190 6:71735128-71735150 TAGAAAAGTAGTTCTGTTGATGG - Intergenic
1010669522 6:78671401-78671423 TTGAGAAGTAAAGCTTGTGAGGG + Intergenic
1011941847 6:92852093-92852115 GAGAAAAGGAATTCTGTTGAGGG + Intergenic
1013355255 6:109340801-109340823 TACAAAAGTTAAGTTGTAGAAGG + Intergenic
1013870197 6:114748774-114748796 TTGAAAAGAAAACCTTTTGAAGG + Intergenic
1015618549 6:135105339-135105361 TAAAAAAGTAAAGCTGGTTATGG + Intergenic
1015659045 6:135553310-135553332 GAGGAAAGTAAAGCTATGGAAGG - Intergenic
1015917923 6:138236767-138236789 TAGAAAAGAAAAGGTGTTTTAGG - Intronic
1016513684 6:144870854-144870876 AATAAAAGTAATGCTGATGAGGG - Intergenic
1016709540 6:147154050-147154072 TAAAAAAGAAAAACTTTTGAAGG - Intergenic
1018412214 6:163561704-163561726 TTTAAAAGTAAAGCTTTTTAGGG + Intronic
1018655675 6:166033547-166033569 TTGAAAAATATAGCTGTTGATGG - Intergenic
1019267096 7:123876-123898 GAGAAAGGTAGAGTTGTTGAAGG + Intergenic
1019771684 7:2887275-2887297 TCGAAAAATATAGCCGTTGATGG + Intergenic
1019967028 7:4507739-4507761 TAAAAAAAAAAAGCTTTTGAAGG - Intergenic
1020809093 7:12829655-12829677 TTGAAGAGTAATGCTGGTGATGG - Intergenic
1021282807 7:18740788-18740810 TAGAAAAGAAAAGCTCTTGAAGG + Intronic
1021472825 7:21025123-21025145 TAGAAAAGGAAACCTTCTGATGG + Intergenic
1021861337 7:24909033-24909055 TAGAAAAGTAGAGAACTTGAGGG - Intronic
1022039003 7:26562119-26562141 TGGAAAAGTAAGGGTGATGAGGG - Intergenic
1022163083 7:27731517-27731539 TAGAAAAGGAATGCAGGTGAAGG + Intergenic
1022951398 7:35341679-35341701 TACAAAGGAAAAGCTATTGAAGG + Intergenic
1023212875 7:37827201-37827223 CATGAAAGTAAAGCTGATGAAGG - Intronic
1024428150 7:49253643-49253665 TATTAAAGTAAAGCTGTTTGGGG - Intergenic
1026624097 7:71977081-71977103 TAGAAAAGAAAAGCTTTATATGG - Intronic
1027496926 7:78899511-78899533 TAGGAAACTAAAGCTTATGAAGG - Intronic
1027670849 7:81095821-81095843 GAGAAAAATAAATCTGTTCAGGG + Intergenic
1027751746 7:82157003-82157025 AAGGAATGTAAAGCTGTTGGAGG + Intronic
1028012915 7:85671988-85672010 TAAAAAAGAAAAGGTGATGATGG - Intergenic
1028532025 7:91848836-91848858 TAAAAAAGAAAAGATGTGGAAGG - Intronic
1029857027 7:103527979-103528001 TAAAAGAGTACAGCTGTTGTGGG + Intronic
1031379303 7:121065612-121065634 TAGAAATGAAAGGCTGTTTATGG + Intronic
1033272048 7:139940627-139940649 GAGAAAAATAAAGCAGTGGAGGG - Intronic
1033659233 7:143392309-143392331 TAGCAAAGTAAATCTGCTGGGGG + Intronic
1034320732 7:150179220-150179242 TATAAAAGAAAATCTGATGAAGG + Intergenic
1034772006 7:153788028-153788050 TATAAAAGAAAATCTGATGAAGG - Intergenic
1035143831 7:156792605-156792627 GAGAGAAGCAAAGCTATTGAAGG + Intronic
1035742868 8:1942269-1942291 AAGAAAAGTAACGCTATTAAAGG + Intronic
1037448895 8:18997085-18997107 TAGAAAGGAAAAGAAGTTGAGGG - Intronic
1037544498 8:19905700-19905722 CTGAAAAGTAAAGTAGTTGATGG + Intronic
1038713996 8:29975274-29975296 CAGAAAAGACAAGGTGTTGAAGG + Intergenic
1038850695 8:31272520-31272542 CAGAAAATTACAGCTCTTGAAGG + Intergenic
1039289792 8:36082033-36082055 TAGAAAGGAAAAGCTGGTGAGGG - Intergenic
1039969878 8:42312640-42312662 TAGAAAACTTAGGCTGTTGATGG - Intronic
1041460133 8:58102339-58102361 AAGAAAAGGTAAGCTGTAGATGG - Intronic
1042709607 8:71702127-71702149 TAGAAATGGAAAGCTTTTGTAGG + Intergenic
1042803855 8:72750733-72750755 TAAAAAACAAAAACTGTTGATGG - Intronic
1043220374 8:77655097-77655119 TAAAAAAGAAAAGCAGTAGAGGG - Intergenic
1043626032 8:82259686-82259708 TAGTAAAATAAAGCTGTACAAGG - Intergenic
1044083427 8:87913341-87913363 AGGAAAGGTTAAGCTGTTGATGG - Intergenic
1044257593 8:90083207-90083229 TAGAAGGGGAAAGCTGATGACGG + Intronic
1044435512 8:92157919-92157941 CAGACAATTAAAGCTGCTGAGGG - Intergenic
1045625535 8:104043961-104043983 TAGAAAAGTAAACATGTGGAAGG + Intronic
1045941875 8:107748549-107748571 TAGAAAAGGAAAGCTGATCCCGG - Intergenic
1046480223 8:114807484-114807506 GAGAAAAGTAAAGCTGCATATGG - Intergenic
1046480402 8:114809493-114809515 GAGAAAAGTAAAGCTGCATATGG + Intergenic
1047912835 8:129549212-129549234 AAGAAAAATAATGCTCTTGAAGG - Intergenic
1048339321 8:133526507-133526529 TAGAAAAGGACATCTATTGAGGG + Intronic
1049739474 8:144230388-144230410 TACAAAGGAAAAGCTCTTGAAGG - Intronic
1049919443 9:349720-349742 CAGAAATGTAAATCTGTTAATGG - Intronic
1050353604 9:4762939-4762961 TAGACAAGAAAAGCCGTGGAAGG + Intergenic
1050583974 9:7090735-7090757 TAGAAAACTATACCTGCTGAGGG - Intergenic
1051390434 9:16557566-16557588 TATAAAAGTGAAGCTGTTCTAGG + Intronic
1051910347 9:22148073-22148095 TAGAAAAGTAGAAGTGCTGATGG + Intergenic
1052380929 9:27770206-27770228 GAGAAGAGGAAATCTGTTGAGGG + Intergenic
1052783966 9:32811656-32811678 TGGAAAAGTCAAGCAGTTGAAGG - Intergenic
1053649752 9:40154809-40154831 GAGATGAGAAAAGCTGTTGAAGG - Intergenic
1054534829 9:66221395-66221417 GAGATGAGAAAAGCTGTTGAAGG + Intergenic
1055111369 9:72563308-72563330 GTGAAATGTAAAGCTGATGATGG - Intronic
1057598126 9:96433893-96433915 AAGAAAAGAAAAGCTGGTCAGGG + Intergenic
1057984221 9:99693435-99693457 AAGAAAATTAAAGCTGCTGGAGG - Intergenic
1058150812 9:101461546-101461568 AAGAAAAGCAAAGCTGCTTAAGG - Intergenic
1059091697 9:111366209-111366231 TAGTAAACTAAAACTGATGAGGG - Intronic
1059781147 9:117528982-117529004 AAGAAGAGTAAAGGTGATGAAGG - Intergenic
1059931027 9:119261262-119261284 CAGAAAAGTAAAAATGTTTATGG + Intronic
1202797641 9_KI270719v1_random:139455-139477 GAGATGAGAAAAGCTGTTGAAGG - Intergenic
1186249427 X:7650237-7650259 TAAAAAACTAAAGATCTTGAGGG - Intergenic
1186706787 X:12148235-12148257 TACAAAGGAAAAGCTCTTGAAGG + Intronic
1187227631 X:17388891-17388913 TTGAGAAGTAGAGCTGTTGATGG + Intronic
1187411069 X:19050922-19050944 GAGAAGAGTAAAGCTGAAGAGGG + Intronic
1187737349 X:22318313-22318335 TAGAAAAGTAAAGGTTTTAGGGG - Intergenic
1187793291 X:22974395-22974417 GATAAAAGTCCAGCTGTTGAAGG - Intergenic
1188143239 X:26578175-26578197 TAGAGTAATAAAGCTGGTGAGGG + Intergenic
1189451682 X:41138934-41138956 CAGAGAAGGAAAGCTGTTGTTGG + Intronic
1189830871 X:44971922-44971944 TAGAAAAGTAAAGAGGCTGGGGG + Intronic
1192306284 X:69963419-69963441 GACAAAAGTAAAGCTTTTGAAGG + Intronic
1193271676 X:79536471-79536493 TACAAAAGAAAAGCGTTTGATGG - Intergenic
1193752727 X:85366162-85366184 TTGAAAAATAATGCTGATGAAGG + Intronic
1194259750 X:91678804-91678826 TTGAAAATTAAAACTGTTGTGGG + Intergenic
1194453168 X:94069983-94070005 TATAAAAGAAAAGGTGTTCATGG - Intergenic
1194797030 X:98224672-98224694 TGGAAAAGTAAAGCCTTTTATGG - Intergenic
1195078086 X:101346440-101346462 AAGAAATGAAGAGCTGTTGATGG - Exonic
1195791294 X:108590569-108590591 TAGAAAAGTAAATTTGTAGATGG + Intronic
1196236436 X:113286631-113286653 CAGAGAGGTAAAGCTGTTCAAGG - Intergenic
1197276163 X:124481973-124481995 GAGAAAAGTAAAGTTATTCAAGG + Intronic
1197344178 X:125312362-125312384 TAGAAATGAAAAGTTCTTGAAGG + Intergenic
1198453671 X:136793843-136793865 TAGAAAAGTGAAGCTGCCCAGGG - Intergenic
1199362342 X:146936664-146936686 TAGAAATGTAAAGTTGTTTCTGG + Intergenic
1199391764 X:147288294-147288316 CAGAAAAGTTAAACTGTTGATGG - Intergenic
1200578451 Y:4917997-4918019 TTGAAAATTAAAACTGTTGTGGG + Intergenic
1202272872 Y:23087385-23087407 TTAAAAAGTAAAGGTGATGATGG + Intergenic
1202293154 Y:23333297-23333319 TTAAAAAGTAAAGGTGATGATGG - Intergenic
1202425869 Y:24721129-24721151 TTAAAAAGTAAAGGTGATGATGG + Intergenic
1202444920 Y:24948957-24948979 TTAAAAAGTAAAGGTGATGATGG - Intergenic