ID: 1003959320

View in Genome Browser
Species Human (GRCh38)
Location 6:11194446-11194468
Sequence ATGAAGAGGCATACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 374
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003959320_1003959324 16 Left 1003959320 6:11194446-11194468 CCTTCCTCAGTATGCCTCTTCAT 0: 1
1: 0
2: 0
3: 25
4: 348
Right 1003959324 6:11194485-11194507 GATTATAACTGTAATTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003959320 Original CRISPR ATGAAGAGGCATACTGAGGA AGG (reversed) Intronic
901593580 1:10367019-10367041 GTGAAGAGATACACTGAGGAAGG + Intronic
902705414 1:18200886-18200908 ATGAGGAGGGATAATGAGGAGGG + Intronic
903455345 1:23483679-23483701 ATGAAAACGCAAACTGAGGCTGG + Intronic
904776932 1:32915329-32915351 ATGATTAAGCTTACTGAGGAAGG - Intergenic
905646823 1:39630688-39630710 TTTAAGAGGCATTCTGAGGATGG - Intronic
906321604 1:44820719-44820741 ATGAGGAGGCTTAGTGAGGCTGG + Intronic
906562021 1:46765301-46765323 ATGAAGAGGGATAATTAGGTAGG - Intronic
907182680 1:52584598-52584620 ATGAAGAAGCATGGAGAGGAAGG + Intergenic
907228853 1:52976064-52976086 ATGAAGAGGCATATAGAGTGAGG + Intronic
907305894 1:53513061-53513083 ATGAAGAGGCAGCCTGAAGGGGG - Intronic
908081784 1:60588568-60588590 ATGAAGAGAAATAGTGAAGAGGG + Intergenic
908437771 1:64123091-64123113 GTGAGGAGAGATACTGAGGAAGG - Intronic
908802635 1:67896455-67896477 ATGCAGAGGGATTATGAGGAGGG - Intergenic
909076802 1:71058799-71058821 AGGGAGAGGGATACTGGGGAAGG + Intergenic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
909844066 1:80368211-80368233 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
910732705 1:90415503-90415525 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
913270089 1:117084666-117084688 TTGAAGAGGGATGCTCAGGAAGG + Intronic
913293638 1:117298173-117298195 CTGAAGAGGTAAACTGAAGAGGG - Intergenic
915377769 1:155412536-155412558 ATGAAGACATATACTGGGGAAGG - Intronic
915703308 1:157818892-157818914 ATGAAGAAACATATTGATGATGG + Intronic
916599941 1:166282999-166283021 CAGAAGAGGCATTTTGAGGAAGG - Intergenic
916626544 1:166564220-166564242 ATCAACAGGTATACTCAGGAGGG + Intergenic
916665711 1:166965263-166965285 ATGAAGAGGTATCTTGGGGATGG + Intronic
917205561 1:172567393-172567415 AAGAGAAGGAATACTGAGGAAGG - Intronic
917362366 1:174190789-174190811 ATGATTAAGCTTACTGAGGAAGG - Intronic
917538906 1:175894854-175894876 ATGAAGAGGCATATAGGGCAAGG + Intergenic
917669467 1:177259013-177259035 ATGATTAGGCATAGTGAGGAAGG + Intronic
917701568 1:177587085-177587107 ATGAAGAGGAATTGTGAGGATGG - Intergenic
917842991 1:178997494-178997516 ATGATTAAGCATAGTGAGGAAGG - Intergenic
918966076 1:191350163-191350185 ATGAAGAAGGATAGTGATGATGG + Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920250643 1:204620139-204620161 AAGAGAAGGCATATTGAGGAGGG - Exonic
923820413 1:237433737-237433759 AAGAAGAGTTATACTGTGGAAGG + Intronic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924085330 1:240445479-240445501 ATGAAGGGGCACAGTGGGGAGGG + Intronic
1063337616 10:5231592-5231614 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1064002031 10:11671767-11671789 ATGATGAAGCGTAGTGAGGAAGG - Intergenic
1066271805 10:33831306-33831328 ATGAAGAGGCATAGTTTGGGGGG - Intergenic
1066659030 10:37721368-37721390 CTGCAGAGGCATCCTGGGGAGGG + Intergenic
1067011797 10:42721077-42721099 ATGAAGACGCCTACTGAGCCTGG - Intergenic
1067311791 10:45120779-45120801 ATGAAGACGCCTACTGAGCCTGG + Intergenic
1067548145 10:47211355-47211377 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1068792505 10:61042315-61042337 AGCAAGTGGCATATTGAGGAGGG - Intergenic
1069284955 10:66702362-66702384 ATGAAGAGGCATTTTGTGGATGG + Intronic
1069457694 10:68566332-68566354 ATGAAAATGCATCCTGATGAAGG + Intronic
1069736401 10:70657853-70657875 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1069906085 10:71733215-71733237 ATGAAGAGACACACAGAGCAAGG + Intronic
1069944869 10:71978899-71978921 ATGGGGAGGCATCCTGGGGAGGG - Intronic
1071056246 10:81511280-81511302 ATTAAAAGGCATACTGATAAAGG - Intergenic
1071286125 10:84147390-84147412 ATGAAAAAGCATACTGAGCTGGG - Intronic
1073601164 10:104847462-104847484 ATGAACAGTCATGCTTAGGATGG - Intronic
1074524873 10:114254493-114254515 ATGTGGAGGGATACTGATGAGGG - Intronic
1074557554 10:114505826-114505848 AAGAATAGAAATACTGAGGAAGG - Intronic
1075040412 10:119103628-119103650 AAAAAGAGGCGTCCTGAGGATGG - Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075688106 10:124377921-124377943 ATGAAGTGGAATGCTGATGATGG + Intergenic
1075821063 10:125311732-125311754 CTGAAGAGGCATAGTGAGAGTGG - Intergenic
1076294352 10:129373102-129373124 ATGAAGAGACAGACTGAGCTTGG - Intergenic
1076316512 10:129545599-129545621 ATGCAATGGCATCCTGAGGATGG - Intronic
1076332455 10:129680467-129680489 ATGGAAAGGCAGACTCAGGAAGG + Intronic
1076666993 10:132098883-132098905 CTGAGGAGGCTTACTGAGTATGG - Intergenic
1077968953 11:7167369-7167391 CTGAGGAGACATACAGAGGAGGG + Intergenic
1078423751 11:11233069-11233091 AGGAGGAGGCAAACTCAGGAAGG + Intergenic
1078789211 11:14526048-14526070 ATGAAGAGTTATGCTGAGGTAGG - Intronic
1079910482 11:26303540-26303562 ATTAAGAGGGAGACGGAGGAAGG + Intergenic
1080774822 11:35375741-35375763 ATGAGGAGGGCTACAGAGGAGGG + Intronic
1081139246 11:39477002-39477024 ATGAAGAGGCATTTTGTGAATGG + Intergenic
1081205832 11:40274539-40274561 ATGAAAAGGGAGACAGAGGAGGG + Intronic
1081792676 11:45799436-45799458 ACGAAGAGGAAAACTAAGGATGG - Intergenic
1082971657 11:59029187-59029209 ATGATTAAGCATAGTGAGGAAGG - Intronic
1084477653 11:69398187-69398209 CTGAGGAGGGATCCTGAGGAGGG - Intergenic
1084477707 11:69398410-69398432 CTGAAGAGGGATCCCGAGGAGGG - Intergenic
1084477718 11:69398463-69398485 CTGAGGAGGGATCCTGAGGAGGG - Intergenic
1084477722 11:69398476-69398498 CTGAGGAGGAATCCTGAGGAGGG - Intergenic
1084668189 11:70588324-70588346 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1084943254 11:72625555-72625577 AGGAAAAGGCAGCCTGAGGAGGG + Intronic
1085367159 11:75959760-75959782 ATGACAAAGCTTACTGAGGAAGG - Intronic
1085858152 11:80199122-80199144 ATGATTATGCTTACTGAGGAAGG + Intergenic
1085956692 11:81406523-81406545 ATGAAGAGACAAACAGAGGGAGG - Intergenic
1090738041 11:129629468-129629490 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1091441913 12:517602-517624 ATGAATAGGCATTTTGGGGAAGG - Intronic
1091673764 12:2472388-2472410 ATGAATAGGCTTAATGAAGATGG - Intronic
1091854167 12:3725447-3725469 ATAAAGAGACACACAGAGGAGGG - Intronic
1092098012 12:5860223-5860245 AGGAAGAGGCTTCCTGAGGAAGG - Intronic
1092622937 12:10293302-10293324 ATGAATAAGCTTAGTGAGGAAGG - Intergenic
1094200398 12:27789356-27789378 ATAAAGAGGCATACTGCTAAAGG - Intronic
1094205369 12:27834026-27834048 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1094402598 12:30078141-30078163 ATGAAAAGGCATTCTGGGCAGGG - Intergenic
1095657846 12:44691566-44691588 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1096055528 12:48648177-48648199 CTGAAGAGGCACAATGAGGGTGG + Intergenic
1097800928 12:63913051-63913073 AAGAAGAGGCAGATCGAGGAGGG - Intronic
1099092600 12:78332228-78332250 TTAAAGAGGCATACAGATGAAGG + Intergenic
1099162019 12:79253660-79253682 ATGATTAGGCTTAGTGAGGAAGG + Intronic
1101677603 12:106932686-106932708 ATGATGAAGCATAATGAGAAAGG + Intergenic
1102286768 12:111664027-111664049 ATCAAAAGGAATACTGGGGATGG + Intronic
1103893152 12:124254885-124254907 AAGAGGAGGGATACTGAGGCTGG + Intronic
1105575831 13:21650680-21650702 ATCAAGGGACATAATGAGGACGG + Intergenic
1105864325 13:24445612-24445634 ATGAAGAGGTATACAGGGTAAGG - Intronic
1106373044 13:29155544-29155566 ATGAAGAGGCAGGCTCAGGATGG + Intronic
1106890121 13:34235991-34236013 ATGAAGAGGCATTCTGTCAACGG + Intergenic
1107349579 13:39500099-39500121 TTGAAGAAACATACTGAGGCAGG - Intronic
1107516920 13:41138302-41138324 ATGAAGAGACATGCAGAGCAAGG - Intergenic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1109436089 13:62304850-62304872 ATGAAAAGGAAAACTGAGGCAGG + Intergenic
1111156474 13:84334207-84334229 ATAAAAAGGCATACAAAGGAAGG - Intergenic
1111372553 13:87336026-87336048 CTGGAGATCCATACTGAGGATGG - Intergenic
1112170784 13:96969802-96969824 CTGAAAGGGCAGACTGAGGAGGG + Intergenic
1115500075 14:34041813-34041835 ATGTAGAGGCATATGGAGCATGG + Intronic
1116185535 14:41596332-41596354 AAGAAGAGTCATTCTGATGAAGG + Intergenic
1116255624 14:42550843-42550865 AGGAAGAGTCACACTGGGGAAGG - Intergenic
1117728440 14:58696790-58696812 ATGAACAGGCATATTGGGAATGG + Intergenic
1117902236 14:60546901-60546923 ATGAAGAGGCAACCTGTTGAAGG - Intergenic
1118002156 14:61533486-61533508 TTGAGGAGACACACTGAGGAGGG + Intronic
1119593592 14:75913282-75913304 AGGAATAGGCATATTGGGGAGGG - Intronic
1121193073 14:92046843-92046865 ATGAAGAATTATACTGAGGTAGG + Exonic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1124057477 15:26255354-26255376 AAGAAGAGGCAGGCTGAGGCAGG - Intergenic
1125252753 15:37724725-37724747 ATGAGGAGGCTTAGTAAGGAAGG - Intergenic
1125666288 15:41432954-41432976 ACAAACAGGCATACTGAGGTCGG + Intronic
1125870593 15:43098002-43098024 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1127309774 15:57742443-57742465 AAGACGAGGCATTCTGTGGATGG + Intronic
1130077220 15:80699532-80699554 ATGTAGAGACATACAAAGGATGG - Intronic
1132426981 15:101725708-101725730 ATCCAGAGGCTTCCTGAGGAAGG - Intergenic
1132560638 16:591964-591986 ATTAAGAGGCATGCTCAGGCAGG - Intronic
1132799058 16:1742570-1742592 ATGAACAGGAGTAATGAGGATGG + Intronic
1134997719 16:18752563-18752585 ATGAAGAGGCATTCCTGGGAGGG + Intergenic
1135880055 16:26246927-26246949 ATGAAGAGGTACACAGAGCAAGG + Intergenic
1135939718 16:26810482-26810504 ATGAGGAGGCATAAGGGGGATGG + Intergenic
1136033310 16:27519222-27519244 AAGAAGGGGCCTACTGGGGAAGG + Intronic
1136050923 16:27649321-27649343 ATGAAATGGCAATCTGAGGATGG - Intronic
1136097008 16:27963847-27963869 ATGCAAAGGCAGACTCAGGATGG - Intronic
1139447395 16:67006366-67006388 GTGAATAGGGAAACTGAGGAGGG - Intronic
1140940603 16:79718438-79718460 AAGAAGAGGAATATGGAGGAGGG + Intergenic
1141022051 16:80506657-80506679 ATGAAGAGGCAAACAGGAGATGG - Intergenic
1143448792 17:7023586-7023608 AGGAAAAGGCAAACAGAGGAGGG + Intronic
1144150317 17:12436630-12436652 ATGAGGAGGCATCCTGAGCCAGG - Intergenic
1145101452 17:20080981-20081003 AGGAGGAGGCATACTGGGGCAGG - Intronic
1145102168 17:20086382-20086404 GTGAAGAGGCTGGCTGAGGAGGG - Intronic
1145744583 17:27306102-27306124 ATGAAAAGGCATTTTGAAGATGG + Intronic
1146475202 17:33157136-33157158 AGGGAGAGGGACACTGAGGAGGG - Intronic
1146672483 17:34751135-34751157 ATCAAGGGACATAATGAGGATGG + Intergenic
1149305141 17:55340166-55340188 ATTAAGAGACATTCTGAGGATGG - Intergenic
1152034774 17:77865421-77865443 AAGAAAAGGGATTCTGAGGAGGG + Intergenic
1152907767 17:82978259-82978281 ATTAGGAAGCAAACTGAGGAAGG - Intronic
1153106939 18:1538297-1538319 AAGAAAAGGCACACTGAAGAGGG - Intergenic
1153144143 18:2010083-2010105 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1153491276 18:5650747-5650769 ATGATTAAGCATATTGAGGAAGG + Intergenic
1154127799 18:11708193-11708215 ATGATTAAGCTTACTGAGGAAGG - Intronic
1155511911 18:26586547-26586569 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1155562754 18:27097348-27097370 TTGAATAGGCATAGTGAGAATGG - Intronic
1156452817 18:37276072-37276094 AGGAAGAGCCAGACCGAGGAGGG - Intronic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157514270 18:48299696-48299718 ATGAAGAGGCTGAAGGAGGATGG + Intronic
1158360964 18:56672930-56672952 ATGATGACCCATACTGAAGAAGG + Intronic
1158880807 18:61778238-61778260 AGGAATAGGCAAACTGATGAGGG - Intergenic
1159173072 18:64797926-64797948 ATGAATAAGCTTAATGAGGAAGG + Intergenic
1159388838 18:67761605-67761627 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1162702436 19:12527188-12527210 ATGATTAGGCACACTGGGGATGG - Exonic
1163222214 19:15929768-15929790 TTGAATAGGTAAACTGAGGAAGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166328745 19:42066799-42066821 AGGAAGAGGGAGACAGAGGATGG + Intronic
1166348431 19:42181447-42181469 ATGAACAGGCAGAATGAGGAGGG - Intronic
1167346335 19:48947734-48947756 ATGAAGAGACAAACAGAGGCTGG - Intergenic
925439849 2:3876009-3876031 CTGAAGAGGCTGACCGAGGAAGG - Intergenic
926241059 2:11085772-11085794 ATGAAGAGGCAAAATGAATATGG - Intergenic
926493531 2:13555426-13555448 ATGATTAAGCTTACTGAGGAAGG - Intergenic
926657129 2:15420312-15420334 ATTAAGAGGTAGACTGAGGTGGG + Intronic
927659449 2:24980478-24980500 ATGATAAGGCATACAGAGGCTGG - Intergenic
929760840 2:44805133-44805155 ATGGGGAGGCATTCTTAGGAGGG + Intergenic
929866812 2:45724518-45724540 ATGATGAAGCTTAGTGAGGAAGG + Intronic
930203080 2:48563012-48563034 CTGAAGTGGGAAACTGAGGAGGG + Intronic
930250937 2:49033499-49033521 ATGAAGAGGCCAACGCAGGAGGG + Intronic
931174235 2:59836858-59836880 TTGAAGAAGAATACTGATGAAGG - Intergenic
931662753 2:64583135-64583157 ATGAAATGGAATACTAAGGAAGG - Intronic
931735652 2:65191034-65191056 AAGAAAAGACATATTGAGGAGGG + Intergenic
932033339 2:68213252-68213274 ATGATGAAGCTTATTGAGGAAGG - Intronic
933082891 2:78015576-78015598 ATGATTAAGCATAGTGAGGAAGG - Intergenic
933107267 2:78346498-78346520 ATGAACAGCCATACTGAAAATGG - Intergenic
937043022 2:118835727-118835749 ATGAGGAGGAATACGGAGGCGGG + Intergenic
938200821 2:129371700-129371722 ATGAAGACTCATAATGGGGAGGG - Intergenic
940024034 2:149186121-149186143 ATGATTAGTCTTACTGAGGAAGG + Intronic
941172778 2:162159990-162160012 ATGAAGAGGCAAGATGAGGCTGG + Intergenic
942539929 2:177005374-177005396 ATGATTAAGCATAGTGAGGAAGG + Intergenic
942593663 2:177571861-177571883 ATGGAGAGGTAAACTGAGGTTGG + Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943529762 2:189064819-189064841 ATTAAGAGGCATAGGGGGGAAGG - Intronic
943841154 2:192582299-192582321 GTAAAGAGAAATACTGAGGAAGG - Intergenic
944623147 2:201539839-201539861 ATGATTAAGCTTACTGAGGAAGG + Intronic
945575119 2:211521128-211521150 ATGATTAAGCATAGTGAGGAAGG + Intronic
945690911 2:213034396-213034418 ATGATGAGGCTTAGTGAGGAAGG - Intronic
945703757 2:213203566-213203588 AGGGAGAGGCCTACTTAGGAGGG - Intergenic
946047087 2:216830171-216830193 ATGAAGAGGCATATTTGGGAAGG - Intergenic
947421961 2:229949127-229949149 AAAAAGAGGCATCCTGAGGCTGG - Intronic
1169882750 20:10365357-10365379 ATGAAGAGGTATACAGGGAAAGG + Intergenic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1171147241 20:22795601-22795623 CTGAAGAAGCAGACAGAGGAAGG + Intergenic
1172433757 20:34914001-34914023 GTTAAGAGGCCTACTCAGGAAGG + Intronic
1173627228 20:44482072-44482094 AGGAAGAGGCATACACAGAAAGG + Intronic
1174682608 20:52423367-52423389 ATGGATAGGCATTCTGAGGCAGG + Intergenic
1174692522 20:52521750-52521772 ATGATGATGCTTAGTGAGGAAGG - Intergenic
1174964549 20:55197336-55197358 ATGTAGAGGCATCCTGATTAAGG - Intergenic
1175577461 20:60071832-60071854 ATGAAGAGGAACATTGACGAAGG - Exonic
1177461438 21:21416055-21416077 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1179236982 21:39556303-39556325 GTGAAGAGGCAAACTGTGGAGGG + Intergenic
1180891842 22:19294393-19294415 AGGAGAAGGCATACTGAGGCTGG + Intergenic
1183130197 22:35826951-35826973 ATGAAAAGGGACACTGTGGATGG + Intronic
1183612534 22:38919871-38919893 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1183681468 22:39332737-39332759 ATGATTAGGCTTAATGAGGAAGG - Intergenic
1184124764 22:42479290-42479312 ATGAAGAGCCATACAGGCGAGGG - Intergenic
950246322 3:11422711-11422733 ATGATTAAGCATAGTGAGGAAGG - Intronic
950388091 3:12675552-12675574 AAGAAGAGGCATTCTGGGGATGG - Intergenic
950928127 3:16763635-16763657 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
950957969 3:17075101-17075123 ATAATGAAGCTTACTGAGGAAGG - Intronic
951530056 3:23690371-23690393 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
951705944 3:25544678-25544700 CTGAAGTGGCATTTTGAGGAGGG - Intronic
952312855 3:32205934-32205956 CATATGAGGCATACTGAGGAGGG - Intergenic
953551084 3:43903800-43903822 ATGATGAGGTATAATGATGAAGG + Intergenic
953583468 3:44178178-44178200 ATGAAGAGGTATACAGAACAAGG + Intergenic
955949631 3:64229381-64229403 ATGAAGAGCTGTAATGAGGAAGG + Intronic
955975013 3:64471482-64471504 AGGAAGAGGCAAACTGCAGAGGG + Intergenic
957572920 3:81971171-81971193 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
957863711 3:85994577-85994599 ATGATGAAGCTTAGTGAGGAAGG - Intronic
958646088 3:96876378-96876400 ATGAAGAGTCAAACTGATGATGG - Intronic
958661631 3:97076137-97076159 ATGATTAGGCTTAATGAGGAAGG + Intronic
958990598 3:100839652-100839674 AAGAAGTGGCATCGTGAGGAGGG + Intronic
959721681 3:109497875-109497897 ATGATTAAGCTTACTGAGGAAGG - Intergenic
959873540 3:111355664-111355686 ATGATGAAGCTTAGTGAGGAAGG + Intronic
959988389 3:112602412-112602434 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
960242243 3:115358744-115358766 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
960583833 3:119302864-119302886 ATGAAGAGTCATAATAACGATGG + Intronic
961077690 3:123997148-123997170 ATAAAGAGGCATATTGTGGTAGG - Intergenic
961092165 3:124122877-124122899 ATGATGAAGCTTAGTGAGGAAGG + Intronic
961860308 3:129911948-129911970 CTGAAGTGGCATAATTAGGATGG - Intergenic
962772586 3:138626973-138626995 ATGAACAGGCATCATGAGAAAGG - Intronic
962828850 3:139122255-139122277 ATGCAGAGGCATGCTGTGGGAGG - Intronic
963018040 3:140844513-140844535 ATTAACAGGCATAATCAGGAAGG + Intergenic
963181184 3:142358134-142358156 AGGAAGAGCTATACTGAGAATGG - Intronic
963198636 3:142563728-142563750 ATGATTAAGCCTACTGAGGAAGG + Intronic
964535024 3:157711412-157711434 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
967199632 3:187060546-187060568 ATGAAGACACATAGTTAGGAAGG + Intronic
967654954 3:192036177-192036199 ATGCAAATGCATATTGAGGAAGG + Intergenic
968658290 4:1787931-1787953 AGGAAGGGGCATCCTGAAGAGGG + Intergenic
968809816 4:2794732-2794754 CTGAAGAGGCAGACAGAGGGAGG + Intronic
969217901 4:5736938-5736960 ATTATGAAGCATAGTGAGGAAGG + Intronic
970752351 4:19379238-19379260 ATAAAGAGGACTAGTGAGGAAGG - Intergenic
971071179 4:23093987-23094009 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
971360097 4:25930132-25930154 ATGATGAGACATTTTGAGGATGG + Intergenic
971534562 4:27732698-27732720 ATTAAGAGGCATGCTGAGTGGGG - Intergenic
971609719 4:28707632-28707654 ATGATTAGGCTTAATGAGGAAGG + Intergenic
971735660 4:30447116-30447138 GTGAAGAAGCATACACAGGAGGG + Intergenic
972357729 4:38296805-38296827 ATGAAGAGGTATATAGAGCAAGG + Intergenic
973656845 4:53056832-53056854 AGGAAGAGTAATAATGAGGAAGG + Intronic
973996225 4:56462124-56462146 ATGAAGAATCAAAATGAGGACGG + Intergenic
974932850 4:68379333-68379355 CTGAAGAGGCATATTGGGCATGG - Intergenic
975263109 4:72328942-72328964 AGGAAAAGGAATACTGAGTATGG - Intronic
976818160 4:89174511-89174533 AAGAAGGGGCAGAGTGAGGATGG - Intergenic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
977887121 4:102265141-102265163 ATGATTAGGCTTAGTGAGGAGGG - Intronic
979345622 4:119583584-119583606 ATGAATAAGCTTAGTGAGGAAGG - Intronic
979694902 4:123602250-123602272 ATGAATAAGCTTAGTGAGGAAGG + Intergenic
979746057 4:124214661-124214683 AGGAAGAGACAGACTGTGGATGG - Intergenic
980428084 4:132653251-132653273 ATGAAGAGACAACCTGATGAAGG - Intergenic
981500094 4:145440858-145440880 ATGTGCAGGCATCCTGAGGAAGG + Intergenic
982520641 4:156412495-156412517 ATGATTAAGCTTACTGAGGAAGG - Intergenic
982924243 4:161316043-161316065 ATGAAGAGGGAAAATTAGGATGG + Intergenic
983257249 4:165413709-165413731 ATGAACAGGAACACAGAGGAGGG + Intronic
983993432 4:174151206-174151228 AGGAAGAGGCATAATGGGAAAGG + Intergenic
984899122 4:184569044-184569066 ATGATTAGGCTTAATGAGGAAGG - Intergenic
985328340 4:188797762-188797784 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
986032423 5:3906599-3906621 ATAAAGAGACAGATTGAGGAGGG + Intergenic
987896613 5:23954155-23954177 AGGAAGAGGAATGTTGAGGAAGG + Intronic
990573243 5:57100175-57100197 CTGAAGAGGGATAGTGAGAATGG - Intergenic
990874605 5:60469969-60469991 ATGAATAAGCTTAGTGAGGAGGG + Intronic
991281291 5:64917242-64917264 ATGCAGAGGCCTACCGAAGATGG - Intronic
992880244 5:81101294-81101316 ATGAACAGACTTACAGAGGAAGG - Intronic
993513756 5:88803633-88803655 AGGAAGAGGTATAATAAGGATGG - Intronic
994504720 5:100628287-100628309 ATGAAGAAGCACACTTTGGATGG - Intergenic
994506978 5:100655814-100655836 GTGAAGAGCTAAACTGAGGAAGG - Intergenic
996492944 5:124119978-124120000 ATGAATAGGCATAGTGAGAGTGG + Intergenic
996518354 5:124398837-124398859 ATTAAGTGGCATACTGAGTTAGG - Intergenic
999266372 5:150269457-150269479 CTCAAGAGGGAGACTGAGGAGGG - Intronic
999403794 5:151288482-151288504 AGGAAGAGGCAGACAGAGGGAGG + Intronic
1000169022 5:158683469-158683491 ATGAAAAGGCAGACTCAGGGAGG - Intergenic
1001312846 5:170623661-170623683 ACGAAAAGGGATAGTGAGGATGG + Intronic
1001479770 5:172080398-172080420 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1001562765 5:172680157-172680179 ATGAAGAGTAATACAGAGCATGG - Intronic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1002765535 6:235568-235590 ATGAAGAGGATTTCTGAGGAGGG - Intergenic
1003959320 6:11194446-11194468 ATGAAGAGGCATACTGAGGAAGG - Intronic
1004391061 6:15210207-15210229 CAGAAGAGCCATTCTGAGGAAGG + Intergenic
1004460794 6:15834062-15834084 AAGAAGAGGCATGCTGGTGATGG + Intergenic
1004804305 6:19185346-19185368 TTGAAGAAGCACACTGAGAAAGG + Intergenic
1004857189 6:19763256-19763278 ATGATTAGGCATAGTGAGGAAGG + Intergenic
1005491015 6:26347065-26347087 ATGAAGAGGAATTCTGTTGAGGG - Intergenic
1006707669 6:36035553-36035575 ATGATTAAGCATAGTGAGGAAGG + Intronic
1006724789 6:36190136-36190158 ATGAAGTGTCATACTGAAAACGG - Intergenic
1010504495 6:76640638-76640660 AATAACAGGCATATTGAGGAGGG - Intergenic
1012965056 6:105665122-105665144 ATGAATAAGCTTAATGAGGAAGG - Intergenic
1015699485 6:136020111-136020133 AAGAAGAGACACACTGAAGAGGG - Intronic
1016987062 6:149903595-149903617 AGGAAGAGGCAGACGGAAGAGGG + Intergenic
1017234614 6:152106087-152106109 ATTAAGATGCATACTGAGGCCGG - Intronic
1017385003 6:153873217-153873239 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1018276872 6:162142177-162142199 ATGAAAATGCATAGTGAGAAGGG + Intronic
1018791649 6:167153215-167153237 CTAAAGAGGCATTATGAGGATGG + Intronic
1019599205 7:1873156-1873178 ATGAAAAGGGACACTGAGGCAGG - Intronic
1021239926 7:18187850-18187872 AGGAAGAAGCACACTGAAGAAGG - Intronic
1021934091 7:25613186-25613208 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1023193517 7:37609473-37609495 ATGATTAAGCATAGTGAGGAAGG + Intergenic
1023221496 7:37923567-37923589 ATGAATAGTCATATTGAAGATGG + Intronic
1024794151 7:53002968-53002990 ATGAAGAGCCATGTAGAGGATGG + Intergenic
1026256103 7:68713213-68713235 ATGATGAAGCTTAGTGAGGAAGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1026547871 7:71339777-71339799 ATGACGTGGCATACTCAGGGAGG + Intronic
1026642137 7:72136657-72136679 ATGATTAAGCATAGTGAGGAAGG - Intronic
1027006055 7:74693951-74693973 ATGATGAAGCTTAGTGAGGAAGG + Intronic
1027512065 7:79095467-79095489 ATGATTAGGCTTAGTGAGGAAGG - Intronic
1031660061 7:124412688-124412710 ATGAACACTCATACTGAAGAGGG - Intergenic
1031878501 7:127169097-127169119 ATGAGGAAGCTTAATGAGGAAGG + Intronic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033107558 7:138542240-138542262 ATGAGTAAGCTTACTGAGGAAGG - Intronic
1033516456 7:142111533-142111555 ATGAACAGGGATACAGAAGAGGG + Intergenic
1034392074 7:150794573-150794595 CTGAAGACACACACTGAGGAGGG + Intronic
1034886693 7:154803799-154803821 ATGAAGAGCCATGCTGGGGCCGG + Intronic
1035637416 8:1156877-1156899 ATGAGGAGGCTGACTCAGGAAGG + Intergenic
1036223456 8:6939758-6939780 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1036236327 8:7042501-7042523 ATGTAGAGGCAAAATGAGAAGGG + Intergenic
1037561750 8:20081480-20081502 ATTATGAGTCATACTGAGAAAGG + Intergenic
1039364100 8:36912467-36912489 ATGAACAGCCAGACTTAGGAGGG + Intronic
1039598527 8:38812752-38812774 ATGAAGGGGAAAAATGAGGATGG - Intronic
1040315637 8:46259462-46259484 ATGCAGAGGAATGTTGAGGAAGG + Intergenic
1040581436 8:48701797-48701819 ATGAAGATGCAGATTGTGGAGGG + Intergenic
1041403272 8:57467178-57467200 ATGAAGATGGACACTGAGGGAGG - Intergenic
1044089770 8:87984839-87984861 ATGATTAGGCTTAGTGAGGAAGG - Intergenic
1044675517 8:94724468-94724490 TTAAAGAGGCATAATGAGGAAGG + Intronic
1046316780 8:112513262-112513284 ATGATGAAGCTTAGTGAGGAAGG - Intronic
1047257484 8:123226365-123226387 ATCAAAAGGCACACAGAGGAGGG + Exonic
1048902484 8:139052094-139052116 ATGATTAAGCTTACTGAGGAAGG + Intergenic
1051123770 9:13780530-13780552 ATGATTAGGCTTAGTGAGGAAGG + Intergenic
1052099118 9:24421929-24421951 ATGACTTGGCATACTGAAGACGG - Intergenic
1052915783 9:33923510-33923532 AGGAAGAGGCAAGCTGAGGCTGG + Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1053528791 9:38857078-38857100 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054201018 9:62081511-62081533 ATGAAGAAGCCAACTGAGGAAGG + Intergenic
1054637341 9:67506852-67506874 ATGAAGAAGCCAACTGAGGAAGG - Intergenic
1055658739 9:78479438-78479460 ATGATGAGGCTTTCTGGGGAGGG + Intergenic
1055904907 9:81281902-81281924 ATGAAGATGCATCATGAAGAAGG - Intergenic
1056967622 9:91178327-91178349 ATGAACAGGAAAACAGAGGAGGG + Intergenic
1058430127 9:104911001-104911023 ATCAAGAGAGATACTGAGGCCGG - Intronic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1058736876 9:107901833-107901855 ATGATGAGGCTCACAGAGGAGGG - Intergenic
1059756379 9:117297521-117297543 AAGAGGAGACATACTCAGGAAGG + Intronic
1059763397 9:117360918-117360940 ATAAAGGGGCATAATGTGGAAGG - Intronic
1061473708 9:130848169-130848191 ATGAAAAAGCATGCTGGGGAGGG - Intronic
1188039769 X:25358216-25358238 ATGAAGAGGCAGAGTGAGCAAGG - Intergenic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188690113 X:33118890-33118912 GTGAAGAAGCATGCTGAGAAAGG - Intronic
1190449577 X:50565118-50565140 AGGAAGAGGCATAAGGAGTATGG - Intergenic
1190553776 X:51613112-51613134 AGGAAAGGGCAAACTGAGGAGGG + Intergenic
1190795963 X:53742550-53742572 ATGAAGAGACATTCTATGGAAGG + Intergenic
1191957757 X:66664729-66664751 ATGATTAAGCTTACTGAGGAAGG - Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192964262 X:76160093-76160115 AGGAAGAAGCTTACAGAGGAAGG + Intergenic
1194364727 X:93000843-93000865 ATGATGAAGCTTAGTGAGGAAGG + Intergenic
1194549793 X:95282805-95282827 ATGAAGAATAATACAGAGGATGG - Intergenic
1194846495 X:98815740-98815762 ATGATTAAGCATAGTGAGGAAGG - Intergenic
1195216252 X:102706365-102706387 ATTAAGGGGTATACTGAGGCTGG + Intergenic
1195861370 X:109386879-109386901 AAGAAGAGGTATGCTGAGGGGGG + Intronic
1197467419 X:126821408-126821430 AGGAAGAGGCATAGTGAGAAAGG - Exonic
1197655114 X:129108315-129108337 AAGAAGAGGCATACTAGGGGGGG - Intergenic
1199170166 X:144726198-144726220 ATGAAGAGGCAAAGTCAGGAGGG - Intergenic
1199190317 X:144962865-144962887 ATGTAAAGGGATACTGAAGAAGG + Intergenic