ID: 1003960945

View in Genome Browser
Species Human (GRCh38)
Location 6:11208635-11208657
Sequence CTCCATCAGCACAGGGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 7, 3: 34, 4: 307}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003960945_1003960952 14 Left 1003960945 6:11208635-11208657 CCATGGCCCCTGTGCTGATGGAG 0: 1
1: 0
2: 7
3: 34
4: 307
Right 1003960952 6:11208672-11208694 CCAAACTGATCTTCAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003960945 Original CRISPR CTCCATCAGCACAGGGGCCA TGG (reversed) Intronic
900436973 1:2635419-2635441 CTGCAGCAGCCCTGGGGCCAGGG + Intergenic
900477162 1:2881451-2881473 CTCCATGGGCTCTGGGGCCAGGG + Intergenic
901737356 1:11320814-11320836 CTACATGAGGACAGGGGCTATGG - Intergenic
902104083 1:14018945-14018967 CTCCATTATCACATGAGCCAAGG + Intergenic
902562552 1:17286828-17286850 CTCCATCAGGCCTGGGGTCAGGG + Intergenic
902584878 1:17432619-17432641 CTCCATCAGGCCAGAGGGCATGG + Intronic
902746278 1:18476607-18476629 CTCCATGGGCACAGGAGCCATGG + Intergenic
902759564 1:18572349-18572371 CTCCATGAGGGCAGGGCCCAGGG + Intergenic
903283171 1:22261739-22261761 CTCCATAAGCACTAGGGGCAGGG - Intergenic
904520291 1:31090002-31090024 TTCCATTAGGCCAGGGGCCAGGG + Intergenic
904941970 1:34170278-34170300 CCCCCTGAGGACAGGGGCCATGG - Intronic
905474692 1:38217772-38217794 CTCCCCCAGCCCAGTGGCCAAGG - Intergenic
905866058 1:41377421-41377443 CTCCTTCAGAACCTGGGCCAGGG - Intronic
906061562 1:42952502-42952524 CTCCAGCCGCATAAGGGCCAGGG + Intronic
906512447 1:46418205-46418227 CTCCACGAGGACAGGGGCCAGGG - Intergenic
907311889 1:53543517-53543539 CAACATAAGCACAGGGGCCAGGG - Intronic
907935322 1:59036463-59036485 CTCCATCATCCCAGGTGCCTGGG - Intergenic
911440545 1:97920902-97920924 CTTACTGAGCACAGGGGCCATGG + Exonic
912251637 1:108018033-108018055 CTCCTTCAGAACAGGCACCAGGG + Intergenic
912624909 1:111198858-111198880 CTCCACTAGCATAGGGGCGAAGG + Intronic
912711922 1:111956244-111956266 CTCCAGATGCACAGGGGTCAGGG - Intronic
913698239 1:121348335-121348357 TTCCATCTGCACTGTGGCCAGGG + Intronic
914139310 1:144931717-144931739 TTCCATCTGCACTGTGGCCAGGG - Intronic
915728411 1:158035392-158035414 CTCCATCAGCAGAGGGTCCAGGG + Intronic
916475978 1:165169314-165169336 CTCCTTCTGCACAGGGGCACAGG + Intergenic
917281257 1:173379858-173379880 CTGCCTCAGCATAGGGGACATGG - Intergenic
920485638 1:206366991-206367013 TTCCATCTGCACTGTGGCCAGGG + Intronic
920611294 1:207440286-207440308 TTCCATCAGCATAAGGACCAGGG + Intergenic
920611374 1:207441151-207441173 TTCCATCAGCATAAGGACCATGG - Intergenic
920850409 1:209624469-209624491 CTCCAAGAGCTCAGTGGCCAAGG - Intronic
920860076 1:209698789-209698811 CTCCATCTCCACTGGGGGCAGGG + Intronic
921955356 1:220977684-220977706 ACCAATCAGCACAGGGGACAGGG - Intergenic
922171899 1:223162471-223162493 CTCCATTATCCCAGGGCCCAGGG + Intergenic
922871188 1:228903292-228903314 ATACATCAGCACAGAGTCCATGG - Intergenic
922874184 1:228927134-228927156 CACCATGTGCACAGGAGCCAGGG - Intergenic
923095605 1:230773019-230773041 CCCCAGAAGCTCAGGGGCCATGG - Intronic
923346602 1:233059200-233059222 CTCAAGCAGCACAGGAGTCAAGG - Intronic
1063049340 10:2429819-2429841 CACCACCAGCACAGGGCCCAGGG - Intergenic
1064622533 10:17229825-17229847 CTCGAGCAGCTCAAGGGCCAAGG + Exonic
1065122711 10:22544370-22544392 CTCCAGCAGCCCAGAGGCCTTGG - Intronic
1066210707 10:33234893-33234915 CTGCAACAGCACAGGGGCAGTGG + Intronic
1066293407 10:34034132-34034154 CTCCATCAGCTGAGCAGCCATGG + Intergenic
1067684675 10:48459203-48459225 CTCCATCTGCTCTGGGGCCGGGG - Intronic
1067842842 10:49695519-49695541 CTCCTTCAGCACAGGTGCCCCGG - Intronic
1069936103 10:71918116-71918138 TTCCAGCATCACAGGGGGCATGG + Intergenic
1070682440 10:78457796-78457818 CTCCCTGAGCACAAGGGGCATGG + Intergenic
1071563647 10:86660708-86660730 CGCCAGCAGCACAGGCTCCAAGG + Intronic
1072323638 10:94274833-94274855 GCCCATCAGCATAGGTGCCATGG - Intronic
1073818298 10:107232003-107232025 CTCCATCATCACGGGTACCAGGG - Intergenic
1074689872 10:115994681-115994703 CCACATCATCACTGGGGCCAGGG + Intergenic
1074816848 10:117148744-117148766 TTCCATCAGCCCAGGGCTCAGGG - Intergenic
1076058978 10:127398484-127398506 CCTCAGCAGCACAGGAGCCAGGG - Intronic
1076117410 10:127909784-127909806 CTCCATCAGCACATGCGCTTCGG - Intronic
1076139865 10:128070284-128070306 CTGCATCTGCAGAGAGGCCAGGG - Exonic
1076214872 10:128685502-128685524 CTGCATCAGCACAGAGTCCCTGG + Intergenic
1076244274 10:128933945-128933967 CTCCATAGGTACAGGGACCAAGG - Intergenic
1076646267 10:131957168-131957190 CTCCATCTCCACAGGGGCACGGG - Intronic
1076646301 10:131957352-131957374 CTCCATCTCCACAGGGCACAGGG - Intronic
1076646402 10:131957763-131957785 CTCCATCTCCACAGGGGCGCGGG - Intronic
1077067120 11:646547-646569 CTCCATCTGCACAGGCCCCAGGG - Intronic
1077444671 11:2585449-2585471 CCCCATCACCACAGCAGCCAAGG - Intronic
1077803954 11:5571333-5571355 CTCCACCACCATAGGGGCCAGGG + Intronic
1079134545 11:17768926-17768948 CTCCATCACCAGAGTTGCCAAGG - Intronic
1079864616 11:25719572-25719594 CTCCATCAAAAAATGGGCCAAGG - Intergenic
1080866222 11:36197699-36197721 CTCCATAAGGACAGGAACCATGG - Intronic
1081634437 11:44711489-44711511 TTCCCACAGCACAGGGGCCCTGG + Intergenic
1083641744 11:64149400-64149422 CTCCATTTGCACCAGGGCCAGGG - Intronic
1084012534 11:66360652-66360674 CTTCATCAGCTCAGGGTGCAGGG - Intronic
1084095679 11:66909591-66909613 CTCCATCAGCACTGGGGAGCCGG + Intronic
1084150030 11:67283831-67283853 CTGCAGCAGAACAGGGGTCATGG - Intronic
1084193506 11:67509778-67509800 CTCCTTGAGTACAGAGGCCATGG - Intergenic
1084268665 11:68017684-68017706 TTCCCACAGCCCAGGGGCCAGGG - Intronic
1084700713 11:70784810-70784832 GTCCTTCAGCCCCGGGGCCAGGG + Intronic
1084741181 11:71140515-71140537 CTCCATCGGCACTGGGGCAAGGG - Intronic
1086807543 11:91263777-91263799 CTCCCTCTGAACAGGGTCCACGG - Intergenic
1088598625 11:111457307-111457329 CCCCATCTCCAGAGGGGCCAAGG - Intronic
1089585161 11:119505916-119505938 TTGCATCAGCAGAGGGGCCTAGG - Intergenic
1090765172 11:129870129-129870151 TTCCATCACCACAGATGCCAAGG - Exonic
1091358751 11:134958030-134958052 CTCCCTGAGGACAGGGGCCTTGG - Intergenic
1092116679 12:6013877-6013899 CTCCATGAGGACGGGGGACAGGG - Intronic
1092794420 12:12095757-12095779 TTCCATCAGCAAAGAGACCAAGG - Intronic
1093646509 12:21590751-21590773 CACCACCACCACTGGGGCCAAGG + Intronic
1096684116 12:53276658-53276680 CTCCCTCAGCAGGAGGGCCAGGG - Exonic
1096807000 12:54146965-54146987 CTCCAGCAGAACAGGGGCCGTGG + Intergenic
1097166749 12:57090051-57090073 TTCCTTCAGCTCAGGGGCCGTGG - Intronic
1097246668 12:57611141-57611163 CTCCTTCATCGCAGAGGCCAAGG + Intronic
1097958639 12:65511457-65511479 CTCCAGCAGCACATGGCTCAGGG + Intergenic
1099133470 12:78864545-78864567 CTCCATCCCCACAGCGGACAGGG - Intronic
1100256087 12:92884596-92884618 CTCCACCACCATAGGGGCCAGGG - Intronic
1100690904 12:97037646-97037668 CAGCATCAGCACAAGGCCCATGG - Intergenic
1102437759 12:112938634-112938656 CTCCCTCAGGGCAGCGGCCAGGG - Exonic
1102591805 12:113961830-113961852 CTCCATGAGGACAGGGGCTGAGG + Intronic
1103368402 12:120399977-120399999 CTCCATGAGGACAGGGACCTTGG + Intergenic
1103980695 12:124735086-124735108 CCCCAGCAGCACAGGGCCCTTGG + Intergenic
1104301528 12:127569318-127569340 CTCCTTCAGCACAGGGGTGAGGG + Intergenic
1104714673 12:131008560-131008582 CTCCGTCATCACAGGAGCCCTGG - Intronic
1104952991 12:132450861-132450883 CTACATCAGCCCAGGGACCCTGG - Intergenic
1105202802 13:18194361-18194383 CTGGATCCGCACAGCGGCCATGG + Intergenic
1105971406 13:25432234-25432256 CTCGCTCAGCACAGGAGCCAGGG + Intronic
1107438168 13:40400394-40400416 CTCCTTCAGGGCAGGGGCAAAGG + Intergenic
1108858916 13:54829571-54829593 CTCCAGCTGCACAGGAGCCCGGG + Intergenic
1110818276 13:79884916-79884938 CTCCAACAGCACAGAGCCCATGG - Intergenic
1112135935 13:96577661-96577683 CTCCATCAAAACATGGGCGAAGG + Intronic
1112873343 13:104002543-104002565 CTCCATCTGGACAGTGGCCATGG + Intergenic
1113109485 13:106807058-106807080 CTCCCTCAGTACAGCCGCCAAGG - Intergenic
1114615634 14:24066722-24066744 ATTCCCCAGCACAGGGGCCATGG - Intronic
1117885684 14:60359494-60359516 CTCCATGAGGGCAGGGGTCATGG + Intergenic
1118256851 14:64212896-64212918 CTCAATCAGCACAGCATCCAGGG - Exonic
1118589787 14:67392764-67392786 CTCCATGAGCATGGAGGCCAGGG + Exonic
1119322808 14:73741667-73741689 CTCCAGGAGCACAGGGGCTGGGG - Intronic
1119329426 14:73783207-73783229 TTTCCTCAGCACAGGGCCCAGGG + Intronic
1119646334 14:76351110-76351132 CTCCAGCCCCACAGTGGCCAGGG - Intronic
1123996963 15:25725501-25725523 CTGCATCAGCACAGGCCACATGG - Intronic
1124466319 15:29943005-29943027 CTCCATCAGAGCACAGGCCAGGG - Intronic
1124583570 15:30984798-30984820 CAGCCTCAGCACAGGGGCCCAGG + Intronic
1124719736 15:32100849-32100871 CTCCCCCAGGAAAGGGGCCATGG - Intronic
1125504524 15:40259248-40259270 CTCCCTCAGCCCAGTGGCCTTGG + Intronic
1125594065 15:40873346-40873368 CACCAGCAGCACAGGCGCCTGGG + Exonic
1128053943 15:64685818-64685840 CCCCATCAGAACAAGGGCTAAGG + Exonic
1128306376 15:66601468-66601490 CCCCATCAGCAGAGCAGCCAGGG - Intronic
1129792165 15:78348690-78348712 CCCCATAAACACTGGGGCCATGG - Intergenic
1129960231 15:79677556-79677578 CTCAATCAGCCCATGGGACATGG + Intergenic
1131507082 15:93028706-93028728 CTCCGTCAGCCCAGGGGACTTGG + Intergenic
1132030021 15:98431562-98431584 TTCCCACAGCACAGGCGCCAAGG + Intergenic
1132562065 16:600120-600142 CTCCAACATCAAGGGGGCCATGG - Intronic
1132869401 16:2109056-2109078 CTCCAACAGCCCCGCGGCCACGG + Exonic
1133384747 16:5360312-5360334 CTCCCTCAGCAGAAGGGCCCTGG - Intergenic
1134522923 16:14926794-14926816 CTCGTTCAGCACAGTGACCAGGG - Intronic
1134710591 16:16325445-16325467 CTCGTTCAGCACAGTGACCAGGG - Intergenic
1134718010 16:16366542-16366564 CTCCAACAGCCCCGCGGCCACGG - Intergenic
1134718761 16:16369733-16369755 CTCGTTCAGCACAGTGACCAGGG - Intergenic
1134803011 16:17103042-17103064 CTCCATCAGCACTGGAGCAATGG + Exonic
1134856937 16:17527880-17527902 CTCCATGAGAATAGGGACCAAGG + Intergenic
1134949011 16:18343200-18343222 CTCGTTCAGCACAGTGACCAGGG + Intergenic
1134955995 16:18382426-18382448 CTCGTTCAGCACAGTGACCAGGG + Intergenic
1134956741 16:18385617-18385639 CTCCAACAGCCCCGCGGCCACGG + Intergenic
1136114526 16:28086526-28086548 CTCCACCACCAGAGGTGCCATGG + Intergenic
1138599845 16:58047824-58047846 CTCCCCCACCACAGGGGCCTTGG + Intergenic
1139475221 16:67199560-67199582 CTCCTTCAGCACAGCGGCCAGGG - Exonic
1139475514 16:67200703-67200725 CTCCAGCAGCCCAAGGGCCAGGG - Exonic
1139824404 16:69745711-69745733 CTCCACAAGGACAGGGACCAGGG - Intronic
1141640411 16:85337726-85337748 TTCTCTCAGCACAGGGCCCAGGG + Intergenic
1141955975 16:87371550-87371572 CTCCATCACCCCGGTGGCCAGGG + Intronic
1143640334 17:8192717-8192739 CTCCATCTTCCCAGTGGCCAAGG + Intergenic
1144023086 17:11254265-11254287 ATCCCACAGCAGAGGGGCCAAGG - Intronic
1144429708 17:15180257-15180279 CTTCATTAGCACTGAGGCCAAGG + Intergenic
1144573997 17:16417618-16417640 CTCCATCTGCACAGAGGTCCTGG + Exonic
1144862170 17:18311940-18311962 CTCCATGACAACAGGGGCCAGGG - Intronic
1145992676 17:29088507-29088529 CTCCATCAGCTCACAGTCCATGG - Intronic
1146303451 17:31709898-31709920 CTGCATGAGGACAGGGGCCTTGG + Intergenic
1147166080 17:38594137-38594159 CACAAACAGCAGAGGGGCCAAGG - Intronic
1148733917 17:49853880-49853902 CTCCATCAGCTCAGGGGTTCTGG - Intergenic
1148907016 17:50918382-50918404 CTCCTTCACCTCTGGGGCCAGGG - Intergenic
1149535513 17:57430711-57430733 GGCCACCAGCACATGGGCCAGGG - Intronic
1150500528 17:65646794-65646816 CCCCAGCACAACAGGGGCCAGGG + Intronic
1151250259 17:72828757-72828779 CTCCAGCAGCACCTGGACCAGGG - Intronic
1151336845 17:73444842-73444864 CTCCAGCTGCCCAGGAGCCAGGG + Intronic
1151700479 17:75740190-75740212 CACCATCAGCACAGGGCAAAAGG - Intronic
1151716580 17:75834247-75834269 CTCCAGCAGCACCTGGGCCAAGG - Intronic
1152089831 17:78240285-78240307 CTTCTTGACCACAGGGGCCAGGG + Exonic
1152609903 17:81310297-81310319 CTCCAGCTGCGCAGGGGCCGGGG + Intergenic
1152698401 17:81807309-81807331 CTACATGAGCCCAGGGTCCAAGG + Intronic
1152927360 17:83093386-83093408 CTCCACCAGCCCTGGGGACAGGG + Intronic
1153643096 18:7172427-7172449 CTTCTTGAGCAGAGGGGCCACGG + Intergenic
1155201152 18:23518935-23518957 CTCCAACAGCACAGGAGCGGAGG + Exonic
1157575644 18:48741397-48741419 CTCCATCAGCCAAGTGACCAGGG + Intronic
1161089442 19:2352743-2352765 GTCCATCGGCACAGGTGCCGCGG - Intronic
1161568301 19:5015808-5015830 CTGCGACCGCACAGGGGCCAAGG - Intronic
1162336295 19:10062557-10062579 TTCCATAAGAACAGGGACCATGG - Intergenic
1162934179 19:13972931-13972953 CTCCACCAGCACTGGGGCTGGGG - Exonic
1163639098 19:18451406-18451428 CTCCCTCCGCCCAGGGACCAAGG - Intronic
1163702350 19:18792388-18792410 CTCCACCAGCCGAGGGACCATGG - Intergenic
1164824108 19:31271694-31271716 ATCCACCAGCACAGGGTCCCAGG + Intergenic
1166094919 19:40532365-40532387 TTCCCTCAGGACAGGGGACAGGG + Intronic
1166831389 19:45641822-45641844 CTCCAGCAGCAGAGGGTGCAGGG - Intronic
1166965472 19:46527177-46527199 CACCATCAGCACTGGTGCCCGGG - Intronic
1167013886 19:46826980-46827002 CTCCATCACCATAGGGGCCAGGG + Intergenic
1168291761 19:55360646-55360668 CTCCCTCAGCTCTGGGGCCTGGG + Intronic
1168636159 19:57999123-57999145 CTGCAGCACCACAGGGGTCAGGG - Intronic
926545640 2:14235942-14235964 CTCCATCTGTACAGGAGGCATGG - Intergenic
927569335 2:24144679-24144701 TGACCTCAGCACAGGGGCCACGG + Intronic
927698021 2:25251112-25251134 CTCCATCAGGACTGGGGCAGTGG + Intronic
929184865 2:39083145-39083167 CTAAATCAGTAGAGGGGCCAAGG - Intronic
929561159 2:42957511-42957533 CTCCCGCATCTCAGGGGCCAAGG - Intergenic
929994136 2:46814603-46814625 TTCCATCACCACACTGGCCATGG - Intergenic
932401422 2:71483255-71483277 CTCCACCTGCACGGGGGACAGGG + Intronic
933746839 2:85577857-85577879 CCCCACCAGCACAGAGGTCAGGG - Intronic
934113697 2:88765166-88765188 CGCCACCAGCACACGGACCAGGG + Intergenic
935632243 2:105221613-105221635 CCTCATCAGCACAGCAGCCAGGG - Intergenic
936076304 2:109403888-109403910 CTCCACCCTCACAGTGGCCATGG - Intronic
936984998 2:118300616-118300638 CTTCAACAACACAGGAGCCAGGG + Intergenic
940460601 2:153958953-153958975 GTCCATCAGGCCAGGGGCCTAGG + Intronic
941753758 2:169162833-169162855 CTGCAGCAGCACAGGAGACACGG - Intronic
942224691 2:173804936-173804958 CACCTTCAACACAGTGGCCAGGG + Intergenic
943106119 2:183546749-183546771 CTCCGGCAGCACAGGAGCCCAGG + Intergenic
943916711 2:193644230-193644252 CACCATCAGCTAAGGGACCAAGG - Intergenic
948674847 2:239591227-239591249 GTCCATCAGCAATGAGGCCAAGG - Intergenic
948797198 2:240411290-240411312 CCCCACCATCACAGGTGCCAGGG + Intergenic
948930061 2:241126317-241126339 GCCCATCAGCAGAGGAGCCAAGG - Exonic
1169068377 20:2707173-2707195 CTCCCCCAGCCCAGTGGCCATGG - Intronic
1169292892 20:4367886-4367908 CTCCAGCAGCACAGGGCACAGGG - Intergenic
1169424512 20:5485611-5485633 CTCCATCAGCTAAGGGGGGATGG + Intergenic
1170440642 20:16375772-16375794 GTCCTTCAGCACAGGGCCAATGG + Intronic
1171381717 20:24738505-24738527 CCACAACAGCACAGGGGCCTAGG + Intergenic
1172169251 20:32918925-32918947 CTCCCTCTGCACCTGGGCCAAGG - Intronic
1172449516 20:35011988-35012010 CTTCATGAGAGCAGGGGCCATGG + Intronic
1173461571 20:43247326-43247348 CTCAATGAGCACAGGTTCCAGGG + Intergenic
1174170604 20:48615963-48615985 CTCCATGAGGGCAGGAGCCATGG - Intergenic
1175644050 20:60656558-60656580 CTCCTTTAGCACAGATGCCAGGG + Intergenic
1175886232 20:62292410-62292432 CTCCATGTGCACAGACGCCACGG - Intronic
1176078604 20:63260530-63260552 CTCCAAAAGCAGAGAGGCCAAGG - Intronic
1176265103 20:64205149-64205171 CTCCATCTGCAGAGTGGGCAGGG - Intronic
1178491751 21:33057007-33057029 CTCCAACTGCACAGGCCCCATGG - Intergenic
1179792175 21:43762105-43762127 CTCCCTCAGCAGGGGGACCACGG - Exonic
1179995068 21:44970498-44970520 CTCCTGCAATACAGGGGCCAGGG - Intronic
1180009596 21:45040659-45040681 CCCCAGCAGCACATGGGCCTTGG - Intergenic
1180064753 21:45406586-45406608 CTCCATCCCCACAGCGGCCCAGG + Intronic
1180072142 21:45441898-45441920 CGCCCTCAGCACAGGGTCCATGG + Intronic
1180090835 21:45533197-45533219 CACCAGCAGCTCAGTGGCCAAGG - Intronic
1180105751 21:45617116-45617138 CTCCATCAGCTCAGCGGACCAGG + Intergenic
1180568099 22:16692371-16692393 CTCCATGAGGACGGGGGACAGGG - Intergenic
1181052817 22:20245795-20245817 CTCCGTGAGAACTGGGGCCAGGG - Intronic
1181546373 22:23604766-23604788 CTCCATCAGCTCAGGGGACAGGG + Intergenic
1181580391 22:23824918-23824940 CCCCACCAGCACAGGGCACAGGG + Intronic
1181634271 22:24167103-24167125 CGCCACCACCACAGGGACCAGGG + Exonic
1182894871 22:33850778-33850800 CTCCATCAGATGAGGGGCCTGGG - Intronic
1183428387 22:37751563-37751585 CACTATCAGGAAAGGGGCCAGGG + Intronic
1184512158 22:44940142-44940164 CTCCACCAGGGCAGGTGCCACGG + Intronic
1184855537 22:47144505-47144527 CTCAGTAAGCACAGGGGCCAAGG - Intronic
1185153914 22:49182028-49182050 AGCCATCGGCAGAGGGGCCATGG - Intergenic
949164122 3:917037-917059 CTCCATGAGGACAGGAGCCTTGG - Intergenic
951076763 3:18402836-18402858 CTCCATCAGCAGAGAGGGCAAGG + Intronic
953841888 3:46395892-46395914 CTACATCTGCACAGAGTCCACGG - Intergenic
953930589 3:47003893-47003915 CTCCAGCAGCCCTGGGACCACGG - Exonic
955442965 3:58976880-58976902 TCCCATCAGCACAGGGCACAAGG - Intronic
955935631 3:64099908-64099930 CACCATCAGCAGAGAGGCCTGGG + Exonic
956069323 3:65431047-65431069 CTCCATCAACACTGGGGCCTAGG - Intronic
956990087 3:74752271-74752293 CTGCAGCTGCACAGGGGCCCAGG + Intergenic
956990291 3:74754862-74754884 CTCCATGAGGGCAGGGACCAAGG + Intergenic
957362915 3:79182521-79182543 CTTCATCAGCACTGGGGCACAGG + Intronic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
961641056 3:128365072-128365094 CTGATTCAGCACAGGGGCCACGG - Intronic
961942173 3:130649466-130649488 CTCCATCACCACGGCTGCCATGG + Exonic
962354926 3:134685749-134685771 CTCCATCAGAACAGTTACCAGGG + Intronic
962376083 3:134859631-134859653 CTCCATGAGGACAGAAGCCAGGG - Intronic
962708159 3:138064468-138064490 CTCCATGTGCACAGGGGCAGAGG + Intronic
962847689 3:139286191-139286213 CTCCAGCAGCCCAGAGTCCAAGG + Intronic
964614392 3:158646801-158646823 CTCCAACAGCACAGAGAACAAGG - Exonic
966679121 3:182621552-182621574 CTCCATGAGGACAGAGTCCATGG + Intergenic
967779518 3:193419942-193419964 CCCCATCATCTCAGGGTCCAAGG + Intronic
968472798 4:789772-789794 CCCCATCTGCACAGAGGCCTTGG + Intronic
968931428 4:3581555-3581577 CAACATGACCACAGGGGCCATGG - Intronic
971127871 4:23774070-23774092 TTCCTTCAGAACTGGGGCCAGGG - Intronic
979373743 4:119919791-119919813 CTCCATCAAAAAATGGGCCAAGG + Intergenic
981049152 4:140293791-140293813 TTCCATCACCATAGTGGCCATGG - Intronic
985631380 5:1015841-1015863 GTCCAACAGGAGAGGGGCCACGG - Intronic
985702329 5:1381068-1381090 CTCCAGCAGCAGAGCAGCCAGGG + Intergenic
985766103 5:1780276-1780298 CACCATCCCCACAGGAGCCAGGG - Intergenic
991544354 5:67765071-67765093 CCTCATCACCACAGGGGCCATGG + Intergenic
991612265 5:68461881-68461903 CTCCATGAGGACAGGGACCATGG - Intergenic
992149614 5:73890169-73890191 CACCATCAGACCAGGGGGCATGG - Intronic
992256569 5:74927349-74927371 CTCCCTCAGAAGAGGGGGCATGG + Intergenic
993096646 5:83486179-83486201 CTGCAACAGCACAGGGGACAAGG - Intronic
993531320 5:89028411-89028433 ATGCACCAGCAAAGGGGCCATGG - Intergenic
995267525 5:110180738-110180760 CTCCCACAGCACAAGGCCCAGGG - Intergenic
995485529 5:112636493-112636515 CTCCACTAGGACAGGGCCCAGGG + Intergenic
995894680 5:116998254-116998276 TTCCACCAGCACAGGAGCTATGG - Intergenic
996091670 5:119357327-119357349 CTCCATCAGAACACAGGACACGG - Intronic
997214886 5:132102211-132102233 CTCCTGCAGCACAGGGGCCAGGG + Intergenic
1001322580 5:170695018-170695040 CCTCATCATCACTGGGGCCAGGG + Intronic
1001686761 5:173599191-173599213 CTCCATAAACACTTGGGCCAGGG - Intergenic
1001723356 5:173875229-173875251 CTCCATCTGCTCTGGGCCCAGGG + Intergenic
1002520823 5:179792615-179792637 CTCCTCCAGGGCAGGGGCCAGGG - Intronic
1002590972 5:180291695-180291717 ATCCCCCAGCACAGGGGCGACGG + Intronic
1003960945 6:11208635-11208657 CTCCATCAGCACAGGGGCCATGG - Intronic
1006230402 6:32581417-32581439 CTCCATCAGCACAGGTCACTGGG - Intronic
1006583751 6:35092021-35092043 CTCCATCAGTGAAGGGGCCAAGG - Intergenic
1006747086 6:36350613-36350635 CTCCAGCTGCTAAGGGGCCAGGG - Intergenic
1007384265 6:41510124-41510146 CACCACCAGCACTGGGCCCAAGG + Intergenic
1007599741 6:43074581-43074603 CCCCATCAGCTCAGGGACCTCGG - Intronic
1007763579 6:44148432-44148454 GGCCATGAGCACAGGGGTCAGGG - Intronic
1010007353 6:71010464-71010486 CTACATCTGCTCTGGGGCCAGGG + Intergenic
1010595782 6:77762184-77762206 CTACATCTGCAGAGGGTCCATGG - Intronic
1010731309 6:79394393-79394415 CTCCATGAGAGTAGGGGCCAGGG + Intergenic
1010900290 6:81420038-81420060 TTCCAACAGTACAAGGGCCAAGG - Intergenic
1014913348 6:127118733-127118755 CGCCGTCGGCACAGCGGCCATGG - Exonic
1016298529 6:142602544-142602566 CTCCATGAGCACAGGGTTTATGG + Intergenic
1018447075 6:163867614-163867636 CGCCTTCAGGACAGGGGCCTCGG + Intergenic
1019269079 7:135991-136013 CTCAGTGAGCACAGGGGGCAAGG + Intergenic
1019271185 7:150045-150067 CCCCATCTGCAAAGGGGACAGGG - Intergenic
1019510847 7:1416596-1416618 CTCCATGAGGACAGGGTCCTGGG - Intergenic
1020975374 7:14999597-14999619 CACAAGCAGCACAGGGGCCGTGG - Intergenic
1022538046 7:31110264-31110286 CTCCTTGAGCCCAGGGACCATGG + Exonic
1023242534 7:38163138-38163160 CTCCATCAGCATAATGTCCAGGG - Intergenic
1023579332 7:41664509-41664531 CTCTAACAGCTCTGGGGCCAGGG - Intergenic
1024071193 7:45786950-45786972 CTATATCAACACAGGAGCCAAGG - Intergenic
1024518435 7:50282091-50282113 CACAATCAGCACACGGGACAAGG - Intergenic
1028197127 7:87920234-87920256 CCCCATCCCCACAGTGGCCATGG + Intergenic
1028891550 7:95993435-95993457 CACCACCACCACAGGGGCTAAGG - Intronic
1029611968 7:101631203-101631225 CTCCATCTACACAGGGGGAAAGG - Intergenic
1031390841 7:121212626-121212648 CTCCATGAGGGCAGGGGCTATGG + Intronic
1031994815 7:128222980-128223002 CTCCATCAGCCCATGTGGCAAGG - Intergenic
1032620918 7:133530863-133530885 CTCCATCATCACAGATGCCTTGG - Intronic
1034238803 7:149593835-149593857 CTTGAACAACACAGGGGCCAGGG - Intergenic
1034242240 7:149619594-149619616 CTTGAACAACACAGGGGCCAGGG - Intergenic
1034534761 7:151719848-151719870 CTCAGTAGGCACAGGGGCCAGGG - Intronic
1035607371 8:938769-938791 GTGTCTCAGCACAGGGGCCACGG + Intergenic
1035660748 8:1346042-1346064 CACCATGAGCACAGTGCCCATGG - Intergenic
1036690423 8:10941390-10941412 CTCCATCTCCACAGGGCCCATGG - Intronic
1037934730 8:22907857-22907879 CACCATCAGCACTCTGGCCAGGG - Intronic
1038170683 8:25128751-25128773 CTCCATCAGCACAGGAGCTATGG - Intergenic
1038382156 8:27106145-27106167 CTCCATAATCAAAGTGGCCAAGG + Intergenic
1038612193 8:29067927-29067949 GTCCAGCAGCAGAGGGGACAGGG - Exonic
1044529753 8:93293680-93293702 CTTCATCTGCACAGCTGCCATGG - Intergenic
1044565127 8:93654457-93654479 CTCCAGCAACACAGGGGTCCAGG - Intergenic
1044934815 8:97283336-97283358 CTCCATCTTCTCAGGAGCCAAGG - Intergenic
1046633225 8:116643155-116643177 CTCCACAAGGGCAGGGGCCATGG + Exonic
1047299320 8:123599424-123599446 GTTAATCATCACAGGGGCCATGG + Intergenic
1049274251 8:141711733-141711755 CTCCATGAGGACAGGGGCCTCGG + Intergenic
1049421911 8:142520759-142520781 CCCCATCTGCACAGGGGCTGTGG - Intronic
1049446067 8:142632240-142632262 CTCCTTCAGCACCTGGGACAGGG + Intergenic
1049603323 8:143518088-143518110 CTCCTGCAGCACCAGGGCCATGG - Intronic
1049678164 8:143902713-143902735 TTCCACCAGCACAAGGTCCACGG - Intergenic
1049749769 8:144277616-144277638 CACATCCAGCACAGGGGCCACGG - Intronic
1050636305 9:7616548-7616570 ATCAACCATCACAGGGGCCATGG + Intergenic
1052289555 9:26826444-26826466 TTGCCTCAGCACAGGGGACATGG - Intergenic
1052789931 9:32865890-32865912 CACCATCAGCACAGAGGCACAGG + Intergenic
1053125355 9:35576470-35576492 GTCCATCAGGCCAGGGGCCTGGG - Intergenic
1054458701 9:65450374-65450396 CAACATGACCACAGGGGCCATGG + Intergenic
1054956555 9:70917476-70917498 CACCACCAGCACCAGGGCCAAGG + Intronic
1057787117 9:98095671-98095693 CTCCTGCAGCACAGGTGCAAAGG - Intronic
1057891986 9:98876437-98876459 CCCCATCTGCAAAGGGTCCAGGG - Intergenic
1059329934 9:113528565-113528587 CTCCTTCAGCAGAGGAGCTAAGG - Intronic
1059380677 9:113921003-113921025 CTCCATCAGGTTAGGGGCAATGG + Intronic
1059833796 9:118128176-118128198 CTCCATCAGCACTGGAGACTGGG - Intergenic
1060880640 9:127115890-127115912 CACCATCAGCCCGGAGGCCAGGG + Intronic
1062079974 9:134618674-134618696 CTCCCTCAGCAAAGCGGCCAGGG - Intergenic
1062186072 9:135219247-135219269 TTTCATAAACACAGGGGCCAGGG - Intergenic
1062250826 9:135592701-135592723 CTCCGTCCGCACAGGGGCCGAGG - Intergenic
1186153463 X:6701085-6701107 CTCCATTAGCAGTGGGGGCAAGG - Intergenic
1186281418 X:7997150-7997172 TTCCAAGAGGACAGGGGCCAAGG - Intergenic
1187162663 X:16779242-16779264 CTCCAGCAGCCAAGGGACCAAGG - Intergenic
1189407131 X:40735392-40735414 CTCCAGCTGCACTGGGGCCATGG + Exonic
1195361070 X:104084456-104084478 ATCCACCAGCACAGAAGCCATGG + Intergenic
1197710740 X:129665357-129665379 CTCCATAAGGGCAGGGGCCATGG + Intergenic
1201145825 Y:11065014-11065036 CTCCATCAGCACTGGGGCAAGGG - Intergenic
1202251531 Y:22878346-22878368 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202404519 Y:24512095-24512117 CTCCATGTACACAGGGCCCAAGG + Intergenic
1202466260 Y:25157987-25158009 CTCCATGTACACAGGGCCCAAGG - Intergenic