ID: 1003961459

View in Genome Browser
Species Human (GRCh38)
Location 6:11212983-11213005
Sequence AAGCTGATATATGAGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 366}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003961459 Original CRISPR AAGCTGATATATGAGAAAGA TGG Intronic
904061707 1:27716141-27716163 AATCTGACAAATGAGATAGAAGG - Intergenic
904425813 1:30422341-30422363 AAGCTGATAAATGACAGAGCAGG + Intergenic
904725665 1:32545774-32545796 AAGTTTATACATGAGAAAGAGGG - Intronic
904874181 1:33641393-33641415 ATGCTGGTATATGAGAATAAAGG + Intronic
904977567 1:34469794-34469816 AAGCTGAGAGATGTGGAAGAAGG - Intergenic
905131606 1:35764369-35764391 AAGCACATACATGATAAAGAAGG - Exonic
906818635 1:48905488-48905510 AACCTTCTATATGAGAAACATGG - Intronic
908823261 1:68109693-68109715 AAGATTATAAATAAGAAAGAAGG + Intronic
910027490 1:82674314-82674336 AAGCCTATATATGGGAAAAAGGG + Intergenic
910300653 1:85703497-85703519 ATGCTGATATATGACAAAGGTGG + Intronic
911261298 1:95689537-95689559 AAGGTAATAAATGAAAAAGAAGG + Intergenic
911692476 1:100850142-100850164 AAGCAGAGATGTGAGGAAGAAGG + Intergenic
912104195 1:106250115-106250137 ATGATTATATATGAGAAAGGAGG - Intergenic
912902329 1:113665271-113665293 AAGTTGATATATAGGAGAGATGG - Intronic
913015602 1:114731121-114731143 AAGCTGATAATTTAGTAAGAAGG - Intronic
913934970 1:125030125-125030147 AAACTGCTCTATGAAAAAGAAGG - Intergenic
915859632 1:159430427-159430449 AAGGTCATATATGAGTAAGTGGG + Intergenic
917459368 1:175216266-175216288 AAGAAAATAGATGAGAAAGAAGG - Intergenic
917833733 1:178922491-178922513 AAACTGATGTATGACAAAGGTGG - Intergenic
918738186 1:188093650-188093672 ATGTTTATATATGGGAAAGAAGG + Intergenic
919336382 1:196241161-196241183 TAGGTGCTATATGAGAAAGAGGG + Intronic
921818228 1:219587924-219587946 AAACTGAGATATGTGGAAGAGGG - Intergenic
922370711 1:224907891-224907913 ATGTTGATATATGAGAAATGTGG - Intronic
922920964 1:229303060-229303082 AAGCTGCAGTATGAAAAAGAGGG + Intronic
924427696 1:243968289-243968311 GGGCTGATTTATGAGAAAAATGG + Intergenic
1063737882 10:8781614-8781636 AAGATGATACATGGAAAAGATGG + Intergenic
1064016149 10:11773850-11773872 AAGCTAATAAATGCCAAAGAAGG - Intergenic
1064021004 10:11809110-11809132 CACCTGAAATGTGAGAAAGAGGG + Intergenic
1064879760 10:20037790-20037812 AATCTCATCTATGAGAGAGATGG + Intronic
1065061416 10:21905808-21905830 AAGGTGAAATAAGAAAAAGAAGG + Intronic
1066630472 10:37454737-37454759 AAACTGCTAGATGACAAAGAGGG - Intergenic
1066822067 10:39508032-39508054 AAGCTGCTATATAAAAAGGAAGG - Intergenic
1066822861 10:39517127-39517149 AAACTGCTATATCAAAAAGAAGG - Intergenic
1067158394 10:43801926-43801948 AAACTCATATATAACAAAGATGG - Intergenic
1068124535 10:52822803-52822825 AAGCAGGTATAAGAGGAAGAAGG + Intergenic
1068572875 10:58650394-58650416 ATGTTAATACATGAGAAAGAGGG + Intronic
1068851312 10:61744747-61744769 AAGCTGATTTATGATACAGTAGG - Intronic
1069016707 10:63437917-63437939 GATTAGATATATGAGAAAGAAGG - Intronic
1070942874 10:80362091-80362113 AAGCTAAAATATGAGAAGTAGGG + Intronic
1071053582 10:81481071-81481093 AAGATGATATTTGAATAAGAGGG + Intergenic
1071425768 10:85547885-85547907 AGGATGATATATGAGGAAAAAGG - Intergenic
1072186295 10:93042119-93042141 AAACTGAAATATGAGTAAGGGGG - Intronic
1072508997 10:96099272-96099294 AAGCTGAGATAGGAGATTGATGG + Intergenic
1073068710 10:100779961-100779983 AAGTTGATATAAAAGAAAGAGGG - Intronic
1073679492 10:105687027-105687049 AAGCTGAAGCAGGAGAAAGAGGG + Intergenic
1073829914 10:107371977-107371999 GAACTTATAGATGAGAAAGAAGG + Intergenic
1075494786 10:122910702-122910724 AACCTGTAATCTGAGAAAGAGGG - Exonic
1076590002 10:131576527-131576549 AAGCTGATGAAAGAGGAAGACGG + Intergenic
1077418089 11:2435169-2435191 AAGGGGATACGTGAGAAAGAAGG + Intergenic
1078349895 11:10583959-10583981 AAAGAGTTATATGAGAAAGAAGG + Intronic
1079287982 11:19157006-19157028 AGCCTGATGTGTGAGAAAGAAGG - Intronic
1079684131 11:23335158-23335180 AACCAAACATATGAGAAAGAAGG + Intergenic
1080332891 11:31161059-31161081 AAGCTAATAGCTAAGAAAGAGGG - Intronic
1081046795 11:38283810-38283832 AAACAGATATATTAGAATGATGG + Intergenic
1081837649 11:46169999-46170021 AACCTGATTTATGACAAAGATGG + Intergenic
1082143040 11:48631965-48631987 AAGATGATAAAAGATAAAGAAGG - Intergenic
1082155944 11:48813071-48813093 AAGCTGATCTATCAAAAGGAAGG - Intergenic
1082157580 11:48845034-48845056 AAACTGCTCTATGAAAAAGAAGG - Intergenic
1082570237 11:54729329-54729351 AAGATGATAAAAGATAAAGAAGG - Intergenic
1082616994 11:55372710-55372732 AAGACGATAAATGATAAAGAAGG - Intergenic
1082861631 11:57862673-57862695 CAGCTAATATATGGCAAAGAAGG - Intergenic
1083461281 11:62813937-62813959 ATGATAATATAGGAGAAAGATGG - Intronic
1085607459 11:77915040-77915062 AAGTTGAAATATGTCAAAGATGG - Intronic
1087264227 11:96043118-96043140 TAGCTGATCTAAGATAAAGATGG - Intronic
1090951524 11:131477549-131477571 AAGCTGATATAGGAAGCAGAGGG - Intronic
1091155154 11:133365439-133365461 AAGGAGATATGTGAGAAAGATGG - Intronic
1092951699 12:13509655-13509677 AAGCTGAGATCTGAAGAAGAAGG + Intergenic
1093629517 12:21391873-21391895 AAGCCTACATTTGAGAAAGAAGG + Intronic
1093865444 12:24221817-24221839 AAGAAGATATATGAGTAAGGAGG + Intergenic
1093879441 12:24387231-24387253 AAACTGATATGTGAGGAGGATGG - Intergenic
1095125119 12:38467854-38467876 CAGCTAATACATGAGAAAGTTGG - Intergenic
1095327479 12:40913321-40913343 AAGCTGTAATATGTGGAAGAAGG + Intronic
1095335048 12:41013687-41013709 AAGATGATATAAGAGAACGGGGG + Intronic
1097969258 12:65615001-65615023 AAGTTGTTATTTGATAAAGAGGG + Intergenic
1098282635 12:68877085-68877107 AGGCTGATATTTGAAGAAGAAGG - Intronic
1098287258 12:68920074-68920096 AAGCAGAAACAAGAGAAAGAGGG - Intronic
1100863002 12:98827197-98827219 AATCTGATCAATGAGAAAAAGGG - Intronic
1101457365 12:104848926-104848948 AATCTGACATATGACAAAGGAGG + Intronic
1101856697 12:108449622-108449644 ATGCTGAAATATGAGAATGCAGG + Intergenic
1104150183 12:126074751-126074773 AAGCTGACATCTGAGAGGGAAGG - Intergenic
1104863576 12:131939100-131939122 ACGCTGGTCTCTGAGAAAGAAGG - Intronic
1105517253 13:21101797-21101819 AAAATGATACATGAGAAATAAGG - Intergenic
1107873052 13:44764598-44764620 AAGCTGAGAGATGTGAAGGACGG + Intergenic
1111126592 13:83917266-83917288 AAACTTATATATTAAAAAGAGGG - Intergenic
1111382443 13:87476215-87476237 TAACTGGTATATGAGGAAGAGGG + Intergenic
1111473284 13:88714228-88714250 AATTTGATATGTGAGAAAGACGG + Intergenic
1111619191 13:90701361-90701383 AAGCTGACATGTGAGAAATAAGG - Intergenic
1112068983 13:95827047-95827069 AATTTAATATATGATAAAGATGG + Intronic
1112233766 13:97615833-97615855 ACTTTGATATATGACAAAGATGG + Intergenic
1112432318 13:99360804-99360826 AAGATGATATATAATTAAGATGG - Intronic
1112674742 13:101687961-101687983 ATTCTCATACATGAGAAAGAAGG - Intronic
1113651776 13:112038357-112038379 AAACTGATAACTGAGTAAGATGG + Intergenic
1114772748 14:25447074-25447096 AAACTCATGTAGGAGAAAGAGGG - Intergenic
1114836747 14:26211708-26211730 AAGCTGACCCATGAGAAAGAAGG - Intergenic
1114879580 14:26768071-26768093 AAGCTAATATATTAAAAATATGG - Intergenic
1114957427 14:27841255-27841277 AAGCTACTATATGAGAAATGTGG - Intergenic
1116379046 14:44241471-44241493 AAGATGATATTTGAGCAAAAGGG + Intergenic
1117048875 14:51840808-51840830 TAACTGATATAAAAGAAAGAAGG - Intronic
1117195026 14:53331152-53331174 AAGATGATAAATGAGAGAAATGG - Intergenic
1120039351 14:79735096-79735118 AAGCTGCTGTATTAGAAATAGGG - Intronic
1124880771 15:33640473-33640495 AAGCTGACATCTTAGAGAGAGGG - Intronic
1125111115 15:36035540-36035562 AATTTGATATATGACAAAGGTGG + Intergenic
1125653277 15:41334679-41334701 AGGCAGATAAAGGAGAAAGAAGG - Intronic
1126136015 15:45392260-45392282 AAGCTTAGAAATGAGGAAGAAGG + Intronic
1126463683 15:48940325-48940347 GAGCTGATAATTGAGAATGAAGG - Intronic
1126742910 15:51796260-51796282 AGGCTTATATTTGAGCAAGAGGG - Intronic
1127570856 15:60239739-60239761 AAACAGATAAATGAGACAGAAGG + Intergenic
1128911940 15:71523561-71523583 ATGCTGATGTATTAGGAAGATGG + Intronic
1130001555 15:80052160-80052182 AAGTTGACATATGCTAAAGAAGG + Intergenic
1130267532 15:82421542-82421564 AACCTAATATAAAAGAAAGATGG + Intergenic
1130504493 15:84525292-84525314 AACCTAATATAAAAGAAAGATGG - Intergenic
1131036866 15:89228221-89228243 ATGGTGAAATAAGAGAAAGAAGG - Intergenic
1131473688 15:92717827-92717849 CAGCTGAGATATGAGAAAGTAGG - Intronic
1133806823 16:9132040-9132062 CAACTGATATATGAAAAAAATGG + Intergenic
1134364687 16:13566127-13566149 ATTTTGATATATTAGAAAGAGGG + Intergenic
1135958365 16:26975501-26975523 AAGCAGATATTTGAGGAATAGGG - Intergenic
1137279430 16:46962997-46963019 AAGGTTATATTTGATAAAGAAGG - Intronic
1137279865 16:46966928-46966950 AAGGTTATATTTGATAAAGAAGG + Intronic
1138740693 16:59306008-59306030 AAGCTCACATATGAGACACAAGG - Intergenic
1138864222 16:60796615-60796637 AAGCTGATATGTGAGAAGACTGG - Intergenic
1140085032 16:71787615-71787637 AATCTGATATATTAGAAATTGGG - Intronic
1141250028 16:82347281-82347303 CAGCTGATAAATGACAAAGCTGG - Intergenic
1144287829 17:13795642-13795664 AAGGTGATATAGGAGGGAGATGG - Intergenic
1144303489 17:13945642-13945664 AAGCTTATATGTGATAAAGCTGG - Intergenic
1146983439 17:37188544-37188566 CTGCTCATATTTGAGAAAGAAGG + Intronic
1149066789 17:52490055-52490077 AAGATGATACCTGAGAAAGAAGG + Intergenic
1149135787 17:53361872-53361894 TTGCTGATAAATTAGAAAGAGGG - Intergenic
1152489857 17:80623334-80623356 TTGCTGATATATAAGAAAAATGG - Intronic
1153451414 18:5234250-5234272 AACTTGATATATGAGAAAGATGG + Intergenic
1155106688 18:22673948-22673970 AAGATGAAAAATGAGGAAGATGG + Intergenic
1156042463 18:32837889-32837911 CAGCTGAGAAATAAGAAAGAAGG - Intergenic
1158008996 18:52706934-52706956 AAGCTGAAATATAAAAGAGAGGG + Intronic
1158432222 18:57399696-57399718 CAGCTGATGTAGGAGAAAAAAGG + Intergenic
1158866054 18:61638695-61638717 ATGCTGAAATATCAAAAAGATGG + Intergenic
1159052337 18:63432808-63432830 AAACTGATAAATTACAAAGAAGG - Intergenic
1159520257 18:69511204-69511226 CAGATGATATGGGAGAAAGATGG - Intronic
1159535830 18:69713696-69713718 AAACAGATATAAGAGTAAGAAGG - Intronic
1159762813 18:72449596-72449618 GAGCTGCTATTTAAGAAAGAAGG - Intergenic
925842747 2:8007764-8007786 AAGATGGTAAATGAAAAAGAGGG + Intergenic
925983585 2:9196896-9196918 AAGCTGAAGAATGACAAAGATGG + Intergenic
927283298 2:21330641-21330663 AAGTGGGTATATGAGAAAGCAGG + Intergenic
927648677 2:24897805-24897827 AAGCGGGTATAGGAGAGAGAGGG - Intronic
927790483 2:26005652-26005674 CAGCTAATAAATGACAAAGAGGG - Intergenic
929078530 2:38098606-38098628 AAGCTGGTAGTTGAGGAAGAAGG + Intronic
929158098 2:38805976-38805998 AAGCTAATAAAGGAGATAGAGGG + Intronic
929258841 2:39842527-39842549 AACTTAATATATGATAAAGATGG - Intergenic
929365129 2:41145166-41145188 AAACTAAGATATAAGAAAGATGG - Intergenic
929478806 2:42281909-42281931 AAGCTGATATCTGCCTAAGAAGG - Intronic
930333351 2:50014871-50014893 GAACTGATATATGAAAAAAATGG + Intronic
931242373 2:60464853-60464875 GACCTGATGTATGAGAGAGAGGG - Intronic
931818899 2:65932142-65932164 AAGTTGATAAATGACAAAGAGGG - Intergenic
933125150 2:78595403-78595425 AAGCTGGTTAATGATAAAGATGG - Intergenic
933270379 2:80226800-80226822 GAGATGGGATATGAGAAAGAGGG - Intronic
933522090 2:83386922-83386944 AAACTGAAATATGTGACAGAGGG - Intergenic
934479856 2:94626594-94626616 AAGCTACTATATGAGAAATGTGG + Intergenic
934562786 2:95321639-95321661 GAGCTGATTTAAGAGAAACACGG + Intronic
934866127 2:97813498-97813520 AAGATTATATATGACACAGAAGG - Intronic
935847132 2:107178006-107178028 GAGCTGAAATAGGAGAAACAGGG - Intergenic
937062805 2:118992810-118992832 AAGCTGAGAAAAGAGAAGGAAGG - Intronic
937624043 2:124024377-124024399 AAGTTGATTTATGATAAAGCAGG + Intergenic
937717068 2:125044701-125044723 AAGATGATTTAGGATAAAGAAGG - Intergenic
937965075 2:127499827-127499849 CACTTGATATATGACAAAGATGG + Intronic
939352114 2:141052689-141052711 AAGCTGAGATATTAGCAAAATGG - Intronic
939700239 2:145382422-145382444 AAGAGGATATATGACCAAGAAGG + Intergenic
941184217 2:162301142-162301164 ATGGGGAAATATGAGAAAGAAGG + Intronic
941474570 2:165934299-165934321 AAACTGTTATAAGAGAAACACGG + Intronic
943280731 2:185929527-185929549 AGGGTGATTTATGAGAAAGCAGG + Intergenic
943734432 2:191339063-191339085 AAGCAGAAACATGAGAAAGCAGG + Intronic
944583415 2:201152819-201152841 GACCTGATAAAAGAGAAAGATGG + Intronic
944966198 2:204936878-204936900 AATTTGATATATAAGAAAGATGG + Intronic
945140638 2:206682958-206682980 AAGCTAATATGTGAGAAAGCTGG + Intronic
947023409 2:225709589-225709611 AAGCTTATATAGATGAAAGAGGG - Intergenic
947082004 2:226409494-226409516 CAGCTGAAATATGAGGGAGAAGG - Intergenic
947839323 2:233197624-233197646 AAGCAGATAAGAGAGAAAGAAGG - Intronic
1169589392 20:7123432-7123454 AAGCTGCTATTTGATAGAGAGGG - Intergenic
1169734140 20:8819225-8819247 AACTTGATTTATGAGAGAGATGG + Intronic
1170864260 20:20138842-20138864 ATGTTGATATATGATGAAGATGG - Intronic
1171832397 20:30030616-30030638 AAACTGGTCTATGAAAAAGAAGG - Intergenic
1177049848 21:16219762-16219784 ATGCTGAGAGATGAGAATGAAGG + Intergenic
1177290263 21:19102473-19102495 AAGCTGAAAAATAAGAAGGAAGG + Intergenic
1177564542 21:22802024-22802046 CACCTGATTTATGACAAAGATGG + Intergenic
1177622003 21:23608133-23608155 AAGGTCAAATAAGAGAAAGAAGG - Intergenic
1177873465 21:26601815-26601837 ATACTGATACATGAGAAATATGG + Intergenic
1177908184 21:26997667-26997689 AATGTGATATTTGAGAAAGATGG + Intergenic
1179468458 21:41594351-41594373 AGGCTCATATATGAAAAAGGAGG - Intergenic
1179890396 21:44332333-44332355 AAATTGATATATGAGAGAAATGG - Intronic
1183615116 22:38939418-38939440 AAGCTGGTATATGACCAAGGTGG - Intergenic
950883077 3:16338738-16338760 AAGGTGAAAAATCAGAAAGAAGG - Intronic
952018201 3:28984918-28984940 CAGGTCATATTTGAGAAAGAGGG - Intergenic
952352602 3:32554811-32554833 AAGTTGATAAATGAGAGAGGAGG - Intronic
953191089 3:40688765-40688787 AAGTCATTATATGAGAAAGAGGG + Intergenic
954775787 3:53017183-53017205 AAGCTGTTAGAAGATAAAGATGG + Intronic
954883469 3:53851724-53851746 AAGCTGACCTATGAGGAGGAGGG + Intronic
957319408 3:78609720-78609742 ATGCTGATACATGAAAATGATGG - Intronic
957660950 3:83152105-83152127 AAGTTGATATATTAGACATACGG - Intergenic
958208936 3:90442710-90442732 AAGCTGCTCTATCAAAAAGAAGG + Intergenic
958215362 3:90560535-90560557 AATCTGATCTATGAAAAAGGAGG + Intergenic
958623238 3:96590135-96590157 TATATGATATATGGGAAAGAAGG + Intergenic
958740413 3:98063294-98063316 AATCTGATATATGAAAATAAAGG + Intergenic
959550611 3:107651785-107651807 AAGCTGATGTCAGAGAAAAAAGG - Intronic
959649543 3:108738229-108738251 AGGCTGTTATATTAGAAATAGGG - Intergenic
959697073 3:109259950-109259972 AGGCTGAGATGTAAGAAAGAGGG + Intergenic
960355090 3:116642048-116642070 AAACTGGAATTTGAGAAAGAAGG + Intronic
961207058 3:125092665-125092687 AAACTGATGAAGGAGAAAGATGG + Intronic
961976876 3:131035077-131035099 AGGCAGACATATGAGATAGAGGG - Intronic
962168170 3:133072630-133072652 AAGCTGTTATTTTAAAAAGAAGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
964001459 3:151778617-151778639 AAATTGATAGATGGGAAAGATGG + Intergenic
964072650 3:152653420-152653442 AAAGTGATAAAGGAGAAAGAGGG + Intergenic
964424546 3:156537537-156537559 CAGCTGATTTATGAAAGAGAGGG + Exonic
965681222 3:171253534-171253556 AGGCAGATCTATGAGAAAGGAGG - Intronic
966264630 3:178024405-178024427 AAGCTGGGGTATGAGAAAGACGG + Intergenic
966661188 3:182416820-182416842 AATCTGAAGTATTAGAAAGAAGG - Intergenic
967047757 3:185753413-185753435 AAGATGATATATGACATACAGGG + Intronic
967363582 3:188660118-188660140 AAGCAAATCTATGAGAAATACGG - Intronic
968718207 4:2177704-2177726 AAGCTGAGATATTAGAAAGAAGG - Intronic
969515401 4:7645191-7645213 AAACTGAGACATGAGATAGAAGG + Intronic
970912626 4:21294881-21294903 AAGCTGATAAGTGAGGGAGAAGG + Intronic
971099828 4:23453059-23453081 AAGCAGGTTTATGAGAAAGGAGG - Intergenic
971369478 4:26004432-26004454 AAGATGATAGATTAGATAGATGG + Intergenic
971912558 4:32813036-32813058 AAGATGATATATTAGAATGCAGG - Intergenic
972018575 4:34279694-34279716 AAGGAGATATAGGAGAAAGGGGG - Intergenic
972421627 4:38892922-38892944 AAACTGATATTTGACAGAGATGG - Intronic
972839217 4:42911201-42911223 AAGCTGGTATATTACAAAAAAGG + Intronic
973256658 4:48120022-48120044 ATGGTGATATAGGAGAAGGAGGG - Intronic
973644953 4:52940948-52940970 GAGCTGATATATCAGAGAGAAGG - Intronic
974316929 4:60294649-60294671 AAGATGATGAAAGAGAAAGAAGG + Intergenic
974932934 4:68380437-68380459 AATCTGAAATATGAGGAATAGGG + Intergenic
975181957 4:71356158-71356180 ATGCTGACTTGTGAGAAAGAGGG + Intronic
975537297 4:75464557-75464579 AAGCTGAGATATGAGTATAAGGG - Intergenic
975602870 4:76121221-76121243 AATTTAATATATGAGAAAGGTGG - Intronic
975684871 4:76909725-76909747 AAGAGGATATATTTGAAAGAGGG - Intergenic
975802453 4:78075295-78075317 AAGTTGATAGGGGAGAAAGATGG + Intronic
976062261 4:81142155-81142177 AAGCTGATAGCTCAGAAAGAGGG + Intronic
979537091 4:121834920-121834942 ATAGTAATATATGAGAAAGATGG + Intronic
979891406 4:126100174-126100196 CACCTGATATAAGATAAAGATGG - Intergenic
980203769 4:129691133-129691155 AATTTGATATATCAAAAAGATGG + Intergenic
980263598 4:130486685-130486707 AAGCTCATATAAAAGAAAGCAGG + Intergenic
980825949 4:138073344-138073366 TAGCTGATAAATGAAAAAGAAGG + Intergenic
980896245 4:138863572-138863594 AAGCAGATATATTAAAATGAGGG - Intergenic
980901786 4:138911999-138912021 AAGCTGATACATGGGAAAAATGG + Intergenic
981511620 4:145564595-145564617 TACCTGAAATATGAGAAAGAAGG - Intergenic
981728838 4:147876232-147876254 AAGATAATGTATGAGAAAAATGG - Intronic
981763714 4:148222932-148222954 AAATGCATATATGAGAAAGAGGG + Intronic
982609384 4:157554166-157554188 AAACTCTTAAATGAGAAAGACGG - Intergenic
982671648 4:158327269-158327291 AATCTGATATAGGAGAAAACAGG - Intronic
983232692 4:165145536-165145558 AAGGTAAAATATGAGAAACACGG - Intronic
983684954 4:170397343-170397365 AAGCTAATATATAAGAGAAAAGG + Intergenic
983839826 4:172443621-172443643 CAGGTGATATATGAAAAACAAGG + Intronic
984378269 4:178959075-178959097 AAGCAAATAAATGAGAAAAATGG + Intergenic
984842507 4:184081190-184081212 CAGCATATATATGAGAATGAAGG + Intergenic
985987707 5:3531184-3531206 AAGCTGATATATGAGTTAATAGG - Intergenic
986701620 5:10415453-10415475 AAGCTGATAAATGAGACATGTGG - Intronic
986884697 5:12218557-12218579 TAGATGTTATATTAGAAAGATGG + Intergenic
986977276 5:13409265-13409287 AAACTGATAAATGAGCAAGAAGG + Intergenic
987953662 5:24709310-24709332 AAGCAGAAATATGAAAAATAGGG - Intergenic
989413606 5:41148573-41148595 AAGCTGTTTTCTGAGAATGAGGG + Intronic
989841433 5:46077204-46077226 AAGCTGCTCTATGAGAAGAAAGG - Intergenic
989859873 5:46357481-46357503 AAGCTGATCTATCAAAAAGAAGG + Intergenic
989862297 5:46392956-46392978 AAACTGTTCTATGAAAAAGAAGG - Intergenic
990065868 5:51714470-51714492 AAACTGAGATAGGAGAAAGAAGG - Intergenic
991145600 5:63299398-63299420 AAGTTGAGATATGAAATAGAAGG - Intergenic
991467335 5:66927718-66927740 AAACTGATACATGAGGCAGATGG - Intronic
992297431 5:75338925-75338947 AAGCTGGTATTCCAGAAAGAAGG - Intronic
993559321 5:89384768-89384790 AAGCCCAGAAATGAGAAAGAAGG + Intergenic
994621924 5:102173821-102173843 AACCTGATTTATGACAAAGTTGG + Intergenic
995242184 5:109898086-109898108 AAACTGAGAGATGGGAAAGAGGG + Intergenic
996975900 5:129434261-129434283 AAGTTTAGATGTGAGAAAGAGGG - Intergenic
998375302 5:141686762-141686784 AAGTTGAGATCTCAGAAAGATGG + Intergenic
999738144 5:154528121-154528143 AAGCTGATGTTGAAGAAAGAGGG + Intergenic
999883310 5:155891230-155891252 AGGCACATATATGAGAAATAAGG - Intronic
1000501725 5:162060121-162060143 AATTTAATATATGAAAAAGAAGG - Intergenic
1001815312 5:174663827-174663849 AAGCTGAAATAAAAGAAGGAAGG - Intergenic
1002449824 5:179312311-179312333 AAGGTGATATATTAGGAAGTGGG + Intronic
1003707048 6:8544230-8544252 ATGCTCATATATGAGAAATACGG + Intergenic
1003961459 6:11212983-11213005 AAGCTGATATATGAGAAAGATGG + Intronic
1004255814 6:14063215-14063237 GAGATAATATATTAGAAAGAGGG - Intergenic
1004798728 6:19120271-19120293 AAGTTAATATAGGAGAAAAATGG + Intergenic
1004855871 6:19749222-19749244 ACACTGATGTATGAGAAATATGG + Intergenic
1005415045 6:25591358-25591380 TTGCTGATATTTGATAAAGAAGG - Intronic
1005605986 6:27477914-27477936 AAGTAGATAAATGAGGAAGAGGG - Intergenic
1005764381 6:28996376-28996398 AAACTGAGAGAAGAGAAAGAAGG - Exonic
1006284911 6:33085344-33085366 GAGCTGGTATAGAAGAAAGATGG - Intronic
1006533237 6:34675343-34675365 CATTTGATATATGATAAAGATGG + Intronic
1007057857 6:38905704-38905726 AAGCTGAGAACTGAGAAACAGGG - Intronic
1007148916 6:39668016-39668038 AAGCTGGAGTAAGAGAAAGAGGG - Intronic
1007216444 6:40243755-40243777 AAGCTGATATGTGAGTTAGCTGG - Intergenic
1007800948 6:44392394-44392416 AACATGATAGATGAGAAAGAAGG + Intronic
1008231436 6:48989036-48989058 GACCTAATATATGAGACAGATGG + Intergenic
1008774759 6:55024646-55024668 AAGGAGATATATGAGCAAAAGGG - Intergenic
1009428243 6:63538240-63538262 AAGCTGGCATCAGAGAAAGAGGG + Intronic
1010020149 6:71149975-71149997 AATCTCATATGTGATAAAGACGG - Intergenic
1010026095 6:71219135-71219157 AATGTAATATATGATAAAGATGG + Intergenic
1010140901 6:72613486-72613508 AAGATTAAAAATGAGAAAGAAGG - Intergenic
1010935991 6:81862088-81862110 AATGTGATATATGAGAATGATGG - Intergenic
1011165032 6:84437263-84437285 AATCTGAAATATGTCAAAGATGG - Intergenic
1011543642 6:88461176-88461198 AATCTGATATTGCAGAAAGAAGG + Intergenic
1011921252 6:92579588-92579610 AAGATGATAAAAGACAAAGAAGG + Intergenic
1012355137 6:98304923-98304945 TAGATGAAATATGAGAATGATGG + Intergenic
1012484979 6:99711168-99711190 AAGGTGAGAGATGAGAAAGTGGG + Intergenic
1012998910 6:106001622-106001644 AAACTGATACATGATAGAGATGG - Intergenic
1013140533 6:107329428-107329450 AAACTCATATATGAGAAGCAGGG - Intronic
1013164857 6:107580586-107580608 AAGGTGAGATATCAGAAACAGGG + Intronic
1013331426 6:109105460-109105482 AATTTGGTATATGAAAAAGAGGG - Intronic
1013650959 6:112193976-112193998 AATCTGGTCTATGAAAAAGATGG + Intronic
1013864849 6:114682995-114683017 AACCTGAGATACCAGAAAGATGG - Intergenic
1014194127 6:118533029-118533051 AAGCAGTTATATTAGAAAAAGGG + Intronic
1014914167 6:127125324-127125346 AATCTGAGACCTGAGAAAGAAGG + Intronic
1014991137 6:128078466-128078488 AAACTGAGATATGAGAAACTAGG - Intronic
1018007757 6:159639325-159639347 AACTTGGTATAGGAGAAAGATGG + Intergenic
1018238860 6:161753249-161753271 AAGCTAATAAAGGAGACAGAAGG + Intronic
1018536305 6:164823911-164823933 AAGCTGATAGAAGAGAAAAAAGG - Intergenic
1020855158 7:13411387-13411409 CAGCTGACATGTGAAAAAGAAGG - Intergenic
1020954351 7:14721642-14721664 AAGCTTATATAAAAGAAATATGG + Intronic
1021444980 7:20723307-20723329 AAGTTAATATATCATAAAGATGG - Intronic
1021704081 7:23349842-23349864 AATCTGCTACATGAGAAGGAAGG + Intronic
1022145358 7:27533135-27533157 AACCTGGTAGATTAGAAAGAAGG - Intronic
1023066811 7:36386172-36386194 AAGTTGATATATGATAAAAGTGG + Intronic
1023689890 7:42774822-42774844 AAGCTGAAATATGGGCAAAAGGG - Intergenic
1023693913 7:42825065-42825087 AAGGAGAAATGTGAGAAAGAAGG + Intergenic
1024714183 7:52055856-52055878 AAGCCCCTATATGAGAAAAAGGG + Intergenic
1025845550 7:65193207-65193229 AAGTTGAAATATGTCAAAGATGG + Intergenic
1025895772 7:65698920-65698942 AAGTTGAAATATGTCAAAGATGG + Intergenic
1026128963 7:67604914-67604936 CAGCTGATCTATCAGAATGAAGG - Intergenic
1026250391 7:68664938-68664960 ATGTTGATCTATGAGGAAGAAGG + Intergenic
1027241228 7:76330654-76330676 AAGCTGACTTCTGAGAAACATGG + Intronic
1027845832 7:83373506-83373528 AACCTGATATATGATACTGATGG + Intronic
1028662083 7:93289794-93289816 AATCTGGTATATGATAAAGATGG - Intronic
1030323220 7:108191938-108191960 AATTTGATAAAGGAGAAAGATGG + Intronic
1030925672 7:115450978-115451000 AATTTTATATATGAGAAATATGG - Intergenic
1031700952 7:124925815-124925837 CAACTGATCTATGACAAAGATGG + Intronic
1032522897 7:132559913-132559935 AAGCAAAGATATGAGAAACAGGG + Intronic
1032908587 7:136402652-136402674 AAGCTGATATAGGCGTAGGATGG - Intergenic
1033314957 7:140289443-140289465 AAGATAACATTTGAGAAAGATGG + Intergenic
1033624980 7:143101213-143101235 AAACTGAGTTATGAGAAAAATGG - Intergenic
1033709639 7:143928601-143928623 AAGCTGATATATTCCAAGGAGGG + Intergenic
1035924549 8:3713223-3713245 CAGCTGATGTAGGAGAAAAAAGG - Intronic
1036609551 8:10337836-10337858 AAACTGATTTAGCAGAAAGAAGG - Intronic
1037240416 8:16771042-16771064 AGGCTGAAATATGTGAAAGCTGG + Intergenic
1038025225 8:23582485-23582507 AACTTGATATAGGAGAATGATGG + Intergenic
1038244885 8:25846326-25846348 CAGCTGATAAATGAGGTAGAAGG + Intronic
1039945481 8:42125136-42125158 AAGCTCAAAGATGAGACAGAGGG + Intergenic
1040653867 8:49481675-49481697 AAGCACATATATGAGAACTATGG - Intergenic
1042505301 8:69553130-69553152 GAGATCATATATGAGAAAGGAGG - Intronic
1043920671 8:85980030-85980052 AAGCTAAAAGCTGAGAAAGATGG + Intergenic
1044137274 8:88602644-88602666 CAGTTTATATATGAGAAAGGAGG - Intergenic
1045769494 8:105718847-105718869 AAGAAAATATATGTGAAAGAGGG - Intronic
1046101375 8:109617646-109617668 CAGCCTATAAATGAGAAAGATGG - Intronic
1046148897 8:110197679-110197701 TGCCTGATTTATGAGAAAGAAGG - Intergenic
1047349856 8:124063564-124063586 AACTTGGTTTATGAGAAAGATGG - Intronic
1047886147 8:129252172-129252194 AAAGTGATATGTGGGAAAGATGG + Intergenic
1048782640 8:138018340-138018362 AAGCTGTTAAATAAGAAATAAGG + Intergenic
1050845406 9:10210961-10210983 AAACAGATAAATGAGAAAAAGGG + Intronic
1051428132 9:16955051-16955073 AATCTGAAATACGAGAGAGACGG - Intergenic
1051818014 9:21132562-21132584 CTGCTGATATTTTAGAAAGAGGG + Intergenic
1052251638 9:26405408-26405430 AAACTGCCATATGAAAAAGAAGG - Intergenic
1053677979 9:40457010-40457032 AAGCTACTATATGAGAAATGTGG - Intergenic
1053927899 9:43085036-43085058 AAGCTACTATATGAGAAATGTGG - Intergenic
1054285751 9:63167945-63167967 AAGCTACTATATGAGAAATGTGG + Intergenic
1054291052 9:63292536-63292558 AAGCTACTATATGAGAAATGTGG - Intergenic
1054389072 9:64597083-64597105 AAGCTACTATATGAGAAATGTGG - Intergenic
1054506645 9:65919288-65919310 AAGCTACTATATGAGAAATGTGG + Intergenic
1054790123 9:69248670-69248692 AAACTGAAATATAAGAGAGAAGG - Intronic
1055569556 9:77602669-77602691 AAGGTAATAAATGAGAAAAAAGG - Intronic
1056075613 9:83035624-83035646 AAGTTGATAGAAGAGAAATACGG - Intronic
1056242096 9:84657903-84657925 AAGCTGATATTAAAGAAACAAGG + Intergenic
1056417647 9:86392355-86392377 AAGATGAAATGTGACAAAGAAGG + Intergenic
1057125736 9:92614634-92614656 AAAATGATACATGAGAAATAAGG - Exonic
1058387520 9:104455780-104455802 AAGCTGATCTATGTGAATAAAGG + Intergenic
1059738805 9:117129158-117129180 AAGCAGAAATATGAGATATATGG + Intronic
1059976443 9:119722888-119722910 AAACTGAGAGAAGAGAAAGAGGG - Intergenic
1060702768 9:125773243-125773265 AAACTGAAAAATGAGAAGGAAGG + Intronic
1061444589 9:130630765-130630787 CAGCTCATAGATGAGAAAGTTGG + Exonic
1185781468 X:2850955-2850977 AATCTGATATATGTAAAAAAGGG + Intronic
1186592648 X:10947464-10947486 AATCAGATATATGAGAAATGTGG + Intergenic
1186630324 X:11341365-11341387 AAACTGATAAATGAAAAATAGGG - Intronic
1188338982 X:28975852-28975874 TAGGTGATATTTGAGAAAGAGGG + Intronic
1188494328 X:30767436-30767458 AAGCTTATATAACATAAAGATGG - Intergenic
1188830272 X:34887976-34887998 AAGTAAATATATGAGAGAGAGGG - Intergenic
1188834157 X:34935626-34935648 AAGATCATAAAAGAGAAAGAAGG + Intergenic
1189746398 X:44173036-44173058 AAGCTGAATTATAAGAAAAATGG + Intronic
1192215468 X:69155113-69155135 AAGATGATATATAAGAAACAGGG - Intergenic
1192746037 X:73939993-73940015 AAGGCAATATATTAGAAAGAAGG - Intergenic
1192824076 X:74676402-74676424 AAACTGGTATATGATAAAGTTGG - Intergenic
1193266371 X:79475417-79475439 AAGCTGGAATTTGAAAAAGAGGG - Intergenic
1193468403 X:81872988-81873010 ATGATGAAATAGGAGAAAGAAGG - Intergenic
1193764703 X:85513102-85513124 ATGTTGACCTATGAGAAAGATGG + Intergenic
1193883239 X:86952657-86952679 CAGTTGATATATGTTAAAGATGG + Intergenic
1194243145 X:91476451-91476473 AAGTGGAAATATGAGAAATAGGG + Intergenic
1194683977 X:96889097-96889119 AAGCTGATAGATGAGTACAAAGG - Intronic
1196654634 X:118204374-118204396 ACTTTGATATATGACAAAGATGG + Intergenic
1196988183 X:121297872-121297894 TAGCTAATACATGACAAAGATGG - Intergenic
1197654467 X:129101674-129101696 CAGCTGATACATGAAAATGAGGG + Intergenic
1197901232 X:131375026-131375048 AATTTGGTATATGAAAAAGACGG + Intronic
1198431571 X:136571913-136571935 AAAGAGAAATATGAGAAAGAGGG + Intergenic
1198615121 X:138448864-138448886 AAGCTGATAAAAGTGAAAAATGG + Intergenic
1199059897 X:143342869-143342891 CAGCTGATATATGGGGAAGAGGG - Intergenic
1199480631 X:148294835-148294857 AAACAAATATATGATAAAGAAGG - Intergenic
1199902874 X:152194703-152194725 AACTTGATTTATGATAAAGATGG - Intronic
1199922940 X:152428861-152428883 CAGCTGAAAACTGAGAAAGATGG + Intronic
1201675611 Y:16580490-16580512 AAGCTAATATAAGAGATAAAAGG - Intergenic