ID: 1003965787

View in Genome Browser
Species Human (GRCh38)
Location 6:11250888-11250910
Sequence AAAGGTAGTAAGGAATTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 237}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003965787_1003965793 28 Left 1003965787 6:11250888-11250910 CCTGCAAATTCCTTACTACCTTT 0: 1
1: 0
2: 0
3: 23
4: 237
Right 1003965793 6:11250939-11250961 ATTTTAATTTCTCTAGGTACTGG 0: 1
1: 0
2: 2
3: 29
4: 502
1003965787_1003965791 22 Left 1003965787 6:11250888-11250910 CCTGCAAATTCCTTACTACCTTT 0: 1
1: 0
2: 0
3: 23
4: 237
Right 1003965791 6:11250933-11250955 TTCCATATTTTAATTTCTCTAGG No data
1003965787_1003965794 29 Left 1003965787 6:11250888-11250910 CCTGCAAATTCCTTACTACCTTT 0: 1
1: 0
2: 0
3: 23
4: 237
Right 1003965794 6:11250940-11250962 TTTTAATTTCTCTAGGTACTGGG 0: 1
1: 1
2: 0
3: 51
4: 678

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003965787 Original CRISPR AAAGGTAGTAAGGAATTTGC AGG (reversed) Intronic
902661639 1:17908342-17908364 AGAGGTAGTAAGGAAGAGGCAGG + Intergenic
902858954 1:19230825-19230847 AAAGGTAGGAAGGCATGTCCTGG - Exonic
903803315 1:25986252-25986274 AAAGGTAATCTGGAATTAGCAGG + Intronic
906195407 1:43927505-43927527 AGAAGTAGTAACGAATTTGATGG - Intronic
908528681 1:65012503-65012525 TAAGACAGTAAGGAATTAGCAGG + Intergenic
908651422 1:66337281-66337303 CAAGGAAGTAAGGAGTTGGCCGG + Intronic
909262741 1:73514305-73514327 ATAGCTAGTATGGACTTTGCTGG - Intergenic
910268265 1:85364460-85364482 AAGGGTAGTAATGAATATGCAGG - Intronic
911653072 1:100411553-100411575 AAACTTAGTAATGAATTTCCTGG + Intronic
911825801 1:102483551-102483573 AAAGGGAGGAGGGAATTTGTTGG - Intergenic
913251987 1:116919338-116919360 AAAGGTAGACAGGAATTTATTGG - Intronic
916615857 1:166438631-166438653 AAAGATAGTAGGGAATTGGGAGG - Intergenic
917257960 1:173136610-173136632 AAGGAAAGGAAGGAATTTGCAGG + Intergenic
917658256 1:177150259-177150281 AAAAGTAATAAGCAATTTTCAGG + Intronic
918095389 1:181330072-181330094 TAAGGCAGCAAGGAATGTGCAGG - Intergenic
918378182 1:183929911-183929933 AAAGCTACTAAGGAGTTTCCTGG - Intronic
918525871 1:185464330-185464352 AAAGGCAGTAAGGATTGTGGTGG + Intergenic
918710339 1:187719456-187719478 AAAGGTAGAAAGGTATTTGTTGG - Intergenic
919205612 1:194418850-194418872 TAAGGTAGAAAGTGATTTGCTGG + Intergenic
920350422 1:205334515-205334537 AAAGTTAGAAGGGAATTTTCGGG + Intergenic
921048076 1:211491416-211491438 AAAGGCAGAAAGGAACCTGCTGG + Intronic
923128311 1:231052202-231052224 AAAGGTAGGAACCTATTTGCTGG - Intergenic
924074003 1:240314056-240314078 AAAGCTACTAAGGAAGATGCTGG + Intronic
924850025 1:247818707-247818729 GAGGGTAGTAAGGAGTTTGGAGG + Intergenic
1064833416 10:19497141-19497163 AAAACTAGTAAAGAATGTGCAGG + Intronic
1064923325 10:20542562-20542584 AAATGGAGTAAGGATTTTGAAGG + Intergenic
1065497302 10:26342188-26342210 GAAGGAAGAAAGGAATTTGAGGG + Intergenic
1068796562 10:61088425-61088447 AAATGGAGTAAGGAAATTACCGG - Intergenic
1070470682 10:76775982-76776004 CCAGGTAGTCAAGAATTTGCAGG - Intergenic
1071000412 10:80825101-80825123 CAAGATAGTAAGGAATTGACAGG + Intergenic
1071025244 10:81105167-81105189 AAAGGTAGAAAGAACTTTGTTGG + Intergenic
1071344414 10:84678730-84678752 ATAGATAATAAGGAATTGGCTGG - Intergenic
1071866413 10:89738426-89738448 AAAGCTAGAAAGAAATTTGAAGG + Exonic
1073703832 10:105960022-105960044 CAATGTAATAAGGAATGTGCTGG - Intergenic
1074212384 10:111348225-111348247 GAAGGAAGTAAGGAACATGCTGG + Intergenic
1074923498 10:118044301-118044323 AAATGAAGTGAGGAATTTGAAGG + Intronic
1075142968 10:119856556-119856578 AAAGGCAGAAAGGAATTTTTAGG + Intronic
1078678309 11:13448700-13448722 AAAGCTAGTAAGGAATTGAATGG - Intronic
1079881056 11:25927163-25927185 TAACATAGTAAGGAATTTCCAGG - Intergenic
1082780820 11:57286248-57286270 CAAGGAATTAAGGAATTTGGAGG + Intergenic
1087806546 11:102561612-102561634 ACAGGTAGTAAACAGTTTGCAGG - Intergenic
1092468011 12:8752012-8752034 AATGGTAGTAAAGAATACGCGGG + Exonic
1093881398 12:24407854-24407876 AAACGTAGTAGGGAATTTCGAGG + Intergenic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1093984517 12:25514508-25514530 AAGGGTAGTGGGGGATTTGCAGG + Intronic
1094464092 12:30732519-30732541 AGGGGTAGTAAGGAATTTTTTGG - Intronic
1096380260 12:51151087-51151109 AAAGGAAGTAAGGAACATACAGG + Intronic
1097675220 12:62594339-62594361 AAATGTAGTAAGGTCTTTGAGGG + Exonic
1097878300 12:64663808-64663830 AAACGTGGTAAAGAAATTGCAGG - Intronic
1097938941 12:65282538-65282560 AAAGGAAGAAAGGAATTTGTTGG + Intronic
1098775307 12:74606376-74606398 AAAGATTAAAAGGAATTTGCTGG - Intergenic
1099378496 12:81924527-81924549 CAAGGTAGTAAGGAATAGGAAGG - Intergenic
1100930298 12:99600902-99600924 GAAGGTAGGAAGGAATTTGTAGG - Intronic
1101325553 12:103712446-103712468 AAGCGAAGGAAGGAATTTGCTGG + Intronic
1108716456 13:53083715-53083737 ATAAGTACTAAGGAATTTCCTGG + Intergenic
1109096361 13:58121857-58121879 GAATGTAGTAAGGAATGCGCAGG - Intergenic
1109511855 13:63387137-63387159 AAAGGCAGGCAGGAGTTTGCAGG - Intergenic
1110127704 13:71967482-71967504 AAAGGTAGTAATTATTTTCCAGG + Intergenic
1111965480 13:94857545-94857567 AAAGGTAGAAATGAATTTTCTGG + Intergenic
1114143178 14:19941176-19941198 AAAGGAAGTAAGAAAATTGATGG - Intergenic
1114676471 14:24443480-24443502 AAAGGGAGGAAGGAATCAGCAGG - Intergenic
1115127344 14:30012252-30012274 AAGGGTAGTGAGGAGTTTACGGG + Intronic
1117557804 14:56904563-56904585 AAAGGTAGTAAGGAGGATGAGGG - Intergenic
1117716522 14:58587107-58587129 AAAGGTAGAAGAGAATTTGATGG + Intergenic
1119603540 14:75994694-75994716 ATAGGTATTGAGGATTTTGCTGG + Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1123957745 15:25357125-25357147 TAAAGTAGTAAGTAATTTGGTGG + Intronic
1124129212 15:26970191-26970213 AAAAATAGTAAAGAATTAGCTGG - Intergenic
1126403213 15:48295676-48295698 CAAGGTATTAAGGAAAATGCAGG + Intronic
1126835039 15:52653551-52653573 AGAGACAGTAAGGAATTTGGAGG + Intronic
1129952512 15:79604652-79604674 AAAGGTATTAAGGAACTCACAGG + Intergenic
1129996504 15:80010789-80010811 AATGTGAGTAAGGAATTTGGAGG - Intergenic
1130421578 15:83753121-83753143 AAAGGTAGCCAGGGTTTTGCAGG - Intronic
1132852963 16:2033097-2033119 AAAGGAAGGAAGGAAGCTGCTGG - Intronic
1133169810 16:3975185-3975207 AAAGGTAAAAAGCAGTTTGCTGG + Intronic
1133928126 16:10210285-10210307 AAGGGTAGTAAGGAATTTAGAGG - Intergenic
1135738400 16:24952624-24952646 CCAGGTAGAAAGGAATTTGGTGG + Intronic
1135751651 16:25063167-25063189 AAAGGTTTTAAGGAAGTTACAGG + Intergenic
1138930422 16:61648187-61648209 AAACGTTATAAGGAATTTTCAGG - Exonic
1140122612 16:72096611-72096633 GAAGGTAGGTAGGAATTTGTGGG + Intronic
1140709657 16:77664925-77664947 AAATGTGGTAAGGATTTTGAAGG - Intergenic
1143421061 17:6792626-6792648 AAAGGTAGGAAGGACATTCCAGG - Intronic
1144652577 17:17016776-17016798 AAAGCAAGCAAGGAATGTGCTGG - Intergenic
1145160399 17:20569889-20569911 AAAGCAAGCAAGGAATGTGCCGG + Intergenic
1145357743 17:22177650-22177672 AAAGGTAGTGGGGAGTTTGTAGG + Intergenic
1145361804 17:22217923-22217945 AAAGGTAGTAGGAACATTGCTGG + Intergenic
1145732627 17:27202964-27202986 AAATGTAGTGTGGAAATTGCTGG - Intergenic
1146718259 17:35104278-35104300 AAAGGAAGTTAGGAATTTGAGGG - Intronic
1147520968 17:41172976-41172998 AAAAGCAGTAAGGAATGAGCAGG + Intergenic
1148185855 17:45643247-45643269 AAAGGAGGTGAGGAACTTGCTGG + Intergenic
1148540218 17:48474362-48474384 AAAGGTAGAAAAAAATTAGCTGG + Intergenic
1149549796 17:57531905-57531927 AAAGGGAGAAAGGAAAGTGCTGG + Intronic
1149679788 17:58497929-58497951 AAAAGAAGTAAAGAATATGCTGG + Intronic
1149894301 17:60417212-60417234 AAAGAAAGAAAGAAATTTGCTGG - Intronic
1150805701 17:68317139-68317161 AAAGGAAGAAAGGAATCTGGGGG + Intronic
1153939448 18:9965536-9965558 AAAAGAAGAAAGGAATATGCAGG - Intergenic
1154467374 18:14660583-14660605 AGAAGTAGAAAGGAAATTGCAGG + Intergenic
1156241904 18:35262835-35262857 AAAGGTAAGAACAAATTTGCAGG - Intronic
1156330635 18:36118483-36118505 AAAGATAGGTAGGAATTTGGTGG + Intronic
1156873451 18:41976124-41976146 TAAGATAGCAAGGAATTTTCTGG + Intronic
1157022924 18:43808566-43808588 AAAGGTAGTAAAAAATTTGAAGG + Intergenic
1161662910 19:5558255-5558277 AAAGGTAGTGATGACTCTGCTGG + Intergenic
1167128514 19:47568642-47568664 AAAGTAAGGAAGGAAATTGCAGG - Intergenic
1168075598 19:53979455-53979477 AGAGGTAGTAAGTGATTTGCGGG + Intronic
926287546 2:11501783-11501805 AAACATAGCAAGGACTTTGCAGG - Intergenic
929177398 2:38994477-38994499 AAAGCTACTAAAGAATTTGGTGG + Intronic
931174608 2:59840831-59840853 AAAGTTGGTAAGGAATTTCAAGG + Intergenic
932372850 2:71207320-71207342 AAAGGCAGGAGGGAATTTTCGGG + Intronic
933397179 2:81748134-81748156 AAAGGCAGTTAGGATTTTGATGG - Intergenic
935467216 2:103412737-103412759 GAAGCTAATAAGGAATATGCTGG - Intergenic
937629063 2:124078900-124078922 AAAGGTAGAGAGGAATCTCCAGG + Intronic
939046589 2:137257366-137257388 AACAGTAGTAAGCAATTGGCTGG + Intronic
939430418 2:142098174-142098196 GAAGGAAGAAAGAAATTTGCTGG + Intronic
940219131 2:151333240-151333262 AAAGGTATAAAGGAAGATGCTGG + Intergenic
940367712 2:152866958-152866980 TCAGGTGGTCAGGAATTTGCAGG + Intergenic
943331725 2:186567840-186567862 ATAGGTAGTAGTGAAATTGCTGG - Intergenic
943720076 2:191194768-191194790 AAAGCAAGAAAGGAATTTGGAGG - Intergenic
945168012 2:206966846-206966868 AAAGGCAGTAAGGAAGTTGGGGG - Intronic
945545806 2:211149852-211149874 AAAGCTATTAAGAATTTTGCTGG + Intergenic
946571784 2:221032355-221032377 AAAGCTAACAAGGAATTTCCTGG - Intergenic
947946056 2:234103263-234103285 AAATGTGGAAAGGAATATGCAGG + Intergenic
1170332939 20:15235505-15235527 AGAGGTAGTACTGAATTTGCAGG - Intronic
1170600434 20:17837436-17837458 AAAGGGAGGAAGGGATTTGGGGG - Intergenic
1174296472 20:49548746-49548768 GAAGGAAGGAAGGAAATTGCTGG + Intronic
1178830299 21:36050678-36050700 AATGGTAGTAAAGAATACGCGGG + Intronic
1178986472 21:37308570-37308592 AAAGTTAGTGGGGAATTTTCTGG + Intergenic
1181743051 22:24936650-24936672 AAAGGGAGCAAGGCATGTGCAGG - Intronic
1182055399 22:27349555-27349577 ACAGGTAGTTAGGAATGAGCAGG - Intergenic
1182453998 22:30438297-30438319 AGAGGTAGAAAGGAATCTGGAGG - Intergenic
1182939282 22:34259363-34259385 AAAGTTAATGAGGAATTTGGGGG + Intergenic
1185303139 22:50094287-50094309 AAATTTAGTAAGAAATTTACAGG - Intronic
950122061 3:10488456-10488478 GAAGGAAGGAAGGAATTTGTAGG - Intronic
950146834 3:10656156-10656178 AAAGGTGGTGAGGAAGTTGCTGG + Intronic
950366065 3:12484886-12484908 ACAGGGAGTTAGGAATTGGCGGG + Intronic
951161983 3:19434566-19434588 AAAGGTGGCAAGCAGTTTGCTGG - Intronic
952409393 3:33033795-33033817 AAAGGTGGTAAGGAATGGGGAGG + Intronic
952747768 3:36797570-36797592 AAAGGTAGAATGGAATTCTCTGG - Intergenic
953457524 3:43054736-43054758 TAAGGTACTAAAGAATTTTCTGG + Intronic
955238619 3:57161419-57161441 AAAGGTAGGAAGGAATAGGGTGG - Intronic
955330404 3:58042508-58042530 AAAAGTAGAAATAAATTTGCTGG - Intronic
955580031 3:60409038-60409060 ATAAATAGTAAGGAACTTGCAGG - Intronic
955595121 3:60581232-60581254 AAAGGTAGTTAGAAGTTTTCAGG + Intronic
956376531 3:68619303-68619325 GAAGGAAGTAAGGAAATTGTAGG + Intergenic
956531807 3:70228824-70228846 AAAGGAATTAAGGAATTTTGAGG - Intergenic
956841743 3:73146544-73146566 AAAGAGACTAAGGAATTTGAGGG + Intergenic
957357492 3:79111351-79111373 AAAACTAGAAAGGAATTAGCTGG + Intronic
958866230 3:99504740-99504762 CAAGTTACTAAGGAATTTGCTGG + Intergenic
960802412 3:121552795-121552817 AAAGGTAGCAGGGAAGTTGGAGG - Intergenic
960905859 3:122600773-122600795 AAAGGTAATAATGAATTTGGGGG - Intronic
961996502 3:131250439-131250461 AAAGGAAGAAAGACATTTGCAGG + Intronic
962298943 3:134219940-134219962 ATAGTTAGTAAGTAATTTGTGGG - Intronic
962485304 3:135836839-135836861 AAAGTTAATAAGAAATATGCAGG + Intergenic
962517972 3:136171293-136171315 AAAGGAAGGAAGGAAGTGGCTGG + Intronic
964194847 3:154051145-154051167 ATAGTTAGTAAGGAATTTATGGG - Intergenic
965026621 3:163310408-163310430 AAAGGTAGTGGGGATTTTGAGGG + Intergenic
965257900 3:166440238-166440260 AAAGGGAGAAGAGAATTTGCAGG + Intergenic
966157672 3:176934741-176934763 AAGGGTGGTCATGAATTTGCAGG - Intergenic
966258241 3:177944336-177944358 AAAGGAAGTGATGAATTTGGGGG - Intergenic
966877132 3:184328801-184328823 AAAGGTGGTAGGGAAATGGCTGG + Intronic
966979545 3:185118918-185118940 AAAGGGACAAAGTAATTTGCAGG - Intronic
967764797 3:193267370-193267392 AATGGTTGTCAGGGATTTGCAGG - Intronic
971061194 4:22972139-22972161 ATAGATAGTAGGGAAATTGCTGG + Intergenic
971924185 4:32985517-32985539 ACTGCTAGTAAGGAATTTGAAGG + Intergenic
974834759 4:67234479-67234501 CAAGATTGTAAGGAATTTGCTGG + Intergenic
975519378 4:75282281-75282303 AAAGGAAGTAAAGAATTGGATGG - Intergenic
978835964 4:113149999-113150021 AAAGGTAGTAGAGAATTCACTGG + Intronic
979957583 4:126973589-126973611 AAAGGTAGTGAGAAATTATCAGG + Intergenic
980561477 4:134482264-134482286 AAAAGTGGTAAGGAATTGGGTGG - Intergenic
981515691 4:145606973-145606995 TAAGGTAGTAAGACATTTCCAGG - Intergenic
982864668 4:160494788-160494810 AAATGTTTTAAGGAATTTACAGG + Intergenic
985249779 4:188012342-188012364 AGAAGTAGCAAAGAATTTGCAGG - Intergenic
986345566 5:6831992-6832014 AGAGATTGTAAGGAATTTGTTGG - Intergenic
988062607 5:26192934-26192956 AAAGGTAGTGAGGAATAAGTGGG + Intergenic
988377099 5:30451030-30451052 AAAGGTAGAGATTAATTTGCTGG + Intergenic
988877464 5:35463097-35463119 AAAGGATGTATGAAATTTGCAGG - Intergenic
988948135 5:36228394-36228416 AAAGGTATAAAGGAATTCGGAGG - Intronic
990341061 5:54823499-54823521 ACAGGTAGTTAGGCATTAGCGGG + Intergenic
992483280 5:77171973-77171995 AAAGCTAGAAAGGATTGTGCTGG - Intergenic
992692184 5:79251663-79251685 AAGGGTAGGAAGGAAGTTGAGGG - Intronic
993928142 5:93898252-93898274 AAAGATAGTAAGGAAAATCCAGG - Intronic
994525590 5:100901636-100901658 AAAGCTAGCAAGGAATGGGCTGG - Intronic
996982334 5:129513926-129513948 AAAGGTAGTGAGGAGTTTGAGGG - Intronic
998118056 5:139553674-139553696 AAAGGGTGTAAAGAATTTTCAGG - Intronic
998185004 5:139971703-139971725 AAAGTTAGTAAGAAACGTGCAGG + Intronic
998292880 5:140933072-140933094 ATGGGAAGTAAGGAATTTGTTGG + Intronic
998514918 5:142744168-142744190 AAAGGCAGGAAGAAATTAGCAGG + Intergenic
998608247 5:143659267-143659289 AAATGGAGTTAGAAATTTGCTGG - Intergenic
998657041 5:144193039-144193061 AAAGCTAGCAAGGATTTTGGGGG - Intronic
998701254 5:144702631-144702653 AAAGATAGGAAGAAATGTGCAGG + Intergenic
1001241951 5:170077913-170077935 AAAGGTAGAAGGGATGTTGCCGG - Intronic
1003965787 6:11250888-11250910 AAAGGTAGTAAGGAATTTGCAGG - Intronic
1004015642 6:11729454-11729476 AAAGGTAGCAAGGAATTACCAGG - Intronic
1004213438 6:13677484-13677506 AAAGGTATTAAGTAATTTTTAGG - Intronic
1004558006 6:16718510-16718532 CAAGGGAGTAAGGAAGCTGCTGG + Intronic
1005328767 6:24728630-24728652 AAAGTTGGTAAGAATTTTGCTGG + Intergenic
1005713797 6:28527668-28527690 AAAGGTGGAAAGGAACTGGCTGG - Intronic
1007769834 6:44183774-44183796 AAGGGTGGGAAGGAATCTGCAGG + Intronic
1009503530 6:64447548-64447570 CAAGGTACTAATGAATTTGTGGG - Intronic
1010845858 6:80706122-80706144 CAAGTTTGTAAGGAAATTGCAGG + Intergenic
1011507767 6:88067426-88067448 AAAAGCAGTGAGGAATTGGCTGG + Intergenic
1014732068 6:125043984-125044006 TAAGGTAGTTAAGAAGTTGCAGG - Intronic
1014928953 6:127310088-127310110 AAAGGTAGTGTGGAGTTGGCAGG + Intronic
1016095848 6:140036141-140036163 AAAGGAAATAAGGAGTTTGATGG + Intergenic
1016445059 6:144123148-144123170 CAAGGCAATAAGGAAATTGCTGG - Intergenic
1017606889 6:156144463-156144485 CAAGGATGTAAGGAATTTCCAGG + Intergenic
1019761265 7:2814606-2814628 AAAGGAAATAAGGAATTTTTTGG - Intronic
1021242897 7:18226602-18226624 AAAGGAAGTATGGAATATGGTGG + Intronic
1022575895 7:31496672-31496694 AAAGATAGGAAGGAATATGCTGG + Intergenic
1023088320 7:36594480-36594502 AAAGGTAGTAAGAAAATTCATGG + Intronic
1024048871 7:45604847-45604869 ATAGGTACTAAAGAATTTGCTGG + Intronic
1024971098 7:55071153-55071175 AGAAGTAGAAAGGAATTTGGAGG + Intronic
1024973784 7:55094617-55094639 GAAGTTAGAAAGGAAGTTGCTGG - Intronic
1025586329 7:62793108-62793130 AAAGCTAGAAAGGAGTTTTCTGG + Intergenic
1026435445 7:70393055-70393077 AAGGGTAGTATTGATTTTGCTGG + Intronic
1027463354 7:78483148-78483170 GAAGTTACTAAGGAATTTACAGG - Intronic
1030243474 7:107355789-107355811 ATAGGTAGAAAGGAATTTTTTGG + Intronic
1030673659 7:112363824-112363846 AAATGTAGGAAGGAAGTTGATGG + Intergenic
1031075633 7:117209650-117209672 AAATGTAGTAATGAGGTTGCAGG + Intronic
1031524074 7:122803106-122803128 AAAGGTAATAAGGGAGTTGGAGG - Intronic
1032070485 7:128802766-128802788 AAAGGTAGTACGGAGTTTCCTGG - Intronic
1034352445 7:150425978-150426000 GAAGGAAGGAAGGAATTAGCTGG - Intergenic
1034571545 7:151960260-151960282 ATAGGTGGAAAGGAATTTTCTGG - Intronic
1036145288 8:6249444-6249466 AAAGTCAGAAAGGAATTTACAGG + Intergenic
1037096723 8:14994900-14994922 AAAGGTGTTGAGGAATTTGTTGG - Intronic
1038723085 8:30055562-30055584 CAAGGTAGTAAGGAAGGTACTGG - Intergenic
1039301900 8:36218335-36218357 AAAGGAAGCAAGGAAATTCCGGG - Intergenic
1041864360 8:62552837-62552859 AGAGGTAGAAAGAAAATTGCTGG + Intronic
1042420702 8:68585323-68585345 AAAGGTAGGAAGGAATTTTATGG + Intronic
1044331454 8:90924773-90924795 AAATGTTGTAAGGAATTTCCAGG - Intronic
1046861729 8:119100474-119100496 AAGAGAAATAAGGAATTTGCAGG + Intronic
1046966005 8:120166445-120166467 AAAGAAAGGCAGGAATTTGCAGG - Intronic
1047268652 8:123333091-123333113 AAAGGTAGTGAGGAATGGCCAGG + Intronic
1047991465 8:130290892-130290914 AAAGGGAGTAAGGATTTTAAGGG + Intronic
1050418313 9:5437184-5437206 AAAGGTTGTCTGGAACTTGCAGG - Intronic
1050850254 9:10276306-10276328 AAAGAAAGGAAGGAATGTGCAGG - Intronic
1051310063 9:15760664-15760686 AAAGGTAAAAAGTAATATGCAGG - Intronic
1053040805 9:34869668-34869690 TAAGGTAGTAAGATATATGCAGG - Intergenic
1053118915 9:35530602-35530624 ATAGGTAGAAAGGAATTTTGGGG + Intronic
1054979091 9:71183039-71183061 AAAGATATTAAGTAATTTGGTGG + Intronic
1055711709 9:79070024-79070046 AAAAGTATTATGAAATTTGCAGG - Intergenic
1058930763 9:109716702-109716724 AAAGGGAGAAAGGCATTTGATGG - Intronic
1059134226 9:111788740-111788762 AAAATTAGAAATGAATTTGCTGG - Intronic
1059848895 9:118314582-118314604 CAAGGTAGTATGGAATTAGAAGG - Intergenic
1060310041 9:122451672-122451694 ACAGGTAATAAAGAATTTGTAGG - Intergenic
1061931954 9:133837886-133837908 AAAAGTAGTAAAGATTTTACGGG - Intronic
1185665100 X:1759413-1759435 AAAGGAAAGAAGGAATTTGGAGG + Intergenic
1186756691 X:12678986-12679008 AAATGTAGTTAGGAAGTTGGAGG - Intronic
1188101023 X:26087896-26087918 AAAAGTACTAAGGAAGTTACAGG + Intergenic
1188454501 X:30347245-30347267 AAAGGTATTAAGGATTTTTGAGG + Intergenic
1188777968 X:34245344-34245366 GAAGGTAGTAAGGAATCTAAAGG - Intergenic
1188966096 X:36553978-36554000 AAAGATAGCATGGAATCTGCAGG - Intergenic
1192989658 X:76436113-76436135 AAAGTTAGAAAAGAAATTGCAGG - Intergenic
1194074844 X:89377501-89377523 AAAGGTAGCAAGAAATATGAAGG - Intergenic
1195542079 X:106074380-106074402 AAAGATAGTTGGGGATTTGCGGG + Intergenic
1195542502 X:106078764-106078786 AAAGATAGTGGGGGATTTGCAGG - Intergenic
1195677483 X:107518017-107518039 AGAGGAAGTAAGGAAGTTGAAGG + Intergenic
1196913632 X:120510048-120510070 AAGGGCAGTATGGAATTTGCTGG - Intergenic
1197161307 X:123325679-123325701 AACTGCAGTAAGGAAATTGCAGG + Intronic
1197851551 X:130866664-130866686 AAAAGTTGTAAGGGATTTGTCGG - Intronic
1198981357 X:142399947-142399969 AAGGGTAGTAGGGAATTGGAGGG - Intergenic
1200730444 Y:6731671-6731693 AAAGGTAGCAAGAAATATGAAGG - Intergenic