ID: 1003966524

View in Genome Browser
Species Human (GRCh38)
Location 6:11257279-11257301
Sequence CTGTCAAAACTGAAGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003966524_1003966531 15 Left 1003966524 6:11257279-11257301 CCCACCACCTTCAGTTTTGACAG 0: 1
1: 0
2: 1
3: 20
4: 176
Right 1003966531 6:11257317-11257339 CACATTGGCAAATAACCCCTGGG No data
1003966524_1003966529 0 Left 1003966524 6:11257279-11257301 CCCACCACCTTCAGTTTTGACAG 0: 1
1: 0
2: 1
3: 20
4: 176
Right 1003966529 6:11257302-11257324 CCAAAAATATCTCTACACATTGG 0: 1
1: 2
2: 3
3: 38
4: 239
1003966524_1003966530 14 Left 1003966524 6:11257279-11257301 CCCACCACCTTCAGTTTTGACAG 0: 1
1: 0
2: 1
3: 20
4: 176
Right 1003966530 6:11257316-11257338 ACACATTGGCAAATAACCCCTGG No data
1003966524_1003966532 18 Left 1003966524 6:11257279-11257301 CCCACCACCTTCAGTTTTGACAG 0: 1
1: 0
2: 1
3: 20
4: 176
Right 1003966532 6:11257320-11257342 ATTGGCAAATAACCCCTGGGAGG 0: 1
1: 0
2: 11
3: 119
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003966524 Original CRISPR CTGTCAAAACTGAAGGTGGT GGG (reversed) Intronic
900241863 1:1621110-1621132 CAGTCAAAGCTGAAGCTGGTGGG + Intronic
903933572 1:26879047-26879069 CTGTTAAAACTGAAAATTGTGGG + Exonic
907574685 1:55515464-55515486 CTGTGAAAAATGAAGGGGGTTGG - Intergenic
908281813 1:62546913-62546935 CTGTAAAAATTGAATATGGTAGG - Intronic
916357099 1:163924027-163924049 CTGACAATACTAAAGTTGGTGGG + Intergenic
917962429 1:180155312-180155334 CTGAGAAACATGAAGGTGGTGGG - Intronic
918980443 1:191551125-191551147 CTGTCAAAAATGATGTTCGTTGG - Intergenic
919265486 1:195259030-195259052 CAGTCTAAACTCAAGGAGGTGGG - Intergenic
922960773 1:229644095-229644117 CTGTCAGAACTGAAGGGGGTAGG - Intronic
923205064 1:231751002-231751024 CTGGCAAAACTGAAAGTAATTGG - Intronic
1065536674 10:26721858-26721880 CTGTCAGAACTGAAAGAGGCAGG - Intronic
1067109602 10:43390917-43390939 TTGTCAGAACTGGAGGTGGAGGG - Intronic
1067183443 10:44007356-44007378 CTGACTAAACTCAAGTTGGTTGG + Intergenic
1068258481 10:54544698-54544720 CTAACAATACTGAAGGTGGAAGG - Intronic
1070560461 10:77562814-77562836 CTGGCACAACTGAATGTGCTTGG - Intronic
1071504944 10:86226649-86226671 ATGGGAAAACTGAAGGTGGGAGG - Intronic
1071919085 10:90329242-90329264 CTATAACAACTGAAGGTGGTGGG - Intergenic
1073458238 10:103650584-103650606 CTGGCAAAGCTGAAGGAGGAAGG - Intronic
1074657667 10:115612798-115612820 GTGTCAAAAATTAAGCTGGTAGG - Intronic
1080208408 11:29756813-29756835 CTGTCAAGCCTGCAGGTGGGTGG + Intergenic
1080426260 11:32157438-32157460 TTGTCACAACTGGAGGAGGTGGG + Intergenic
1081284759 11:41254286-41254308 CTTTGAAAAATGAAGGTGATGGG - Intronic
1081776330 11:45678276-45678298 GTGTCAAAACGGCAGGTGGAGGG - Intergenic
1082034934 11:47637288-47637310 CTGTTAAAACTGAAAGTTCTTGG - Intronic
1086082430 11:82918607-82918629 CTGTGAAGAATGATGGTGGTAGG + Intronic
1086167740 11:83798935-83798957 CTCTGAAAAATGAAGGTGCTGGG + Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091841230 12:3622443-3622465 CTGAAATAACTGAAGGTGGAGGG - Intronic
1092582081 12:9852753-9852775 CTGTCAAAACAAAGGGGGGTGGG - Intergenic
1098264709 12:68706686-68706708 CTGTCCAAGCTGGAGGTGGGCGG + Intronic
1099335116 12:81346372-81346394 GTGGCAAAACTGGAGGTAGTAGG - Intronic
1103082987 12:118040204-118040226 CTGTCAAATCTCAGGGTGCTGGG + Intronic
1104497927 12:129258049-129258071 CTGTTTAGACGGAAGGTGGTGGG - Intronic
1108068133 13:46599930-46599952 CTTTCAAAACTAAAGGTATTTGG + Intronic
1110414850 13:75240588-75240610 CTGCCAGAACTGAAGCGGGTCGG - Intergenic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1113590022 13:111492019-111492041 CTGTCAAAACTCACGGTCCTCGG + Intergenic
1113648342 13:112014832-112014854 CTGTCAACACTGAGGGTGCCAGG - Intergenic
1117580697 14:57148794-57148816 TTATGAAAATTGAAGGTGGTTGG - Intergenic
1119026161 14:71154601-71154623 CAGTTAAAAATGAATGTGGTAGG + Intergenic
1120526753 14:85585223-85585245 CCGTCAAACCTGAAGATGGATGG - Intronic
1122068671 14:99191193-99191215 TTGTCAAGACTGAAGGGGCTTGG + Intronic
1122378463 14:101285260-101285282 CTGAGGCAACTGAAGGTGGTTGG - Intergenic
1127294269 15:57595997-57596019 CGGTCAAAAATGATGGTTGTAGG + Intronic
1128601433 15:68998494-68998516 CTGTCAATTCTGTGGGTGGTGGG + Intronic
1128965132 15:72051337-72051359 CTGTCAACTCAGAAGGTGGCAGG - Intronic
1129158779 15:73735279-73735301 AAGTCAAAACTGAAGGGTGTGGG - Intergenic
1129264602 15:74387054-74387076 CTGTCACGAGTGAAGGGGGTTGG - Intergenic
1131088476 15:89599179-89599201 TTGTCATGACTGATGGTGGTGGG - Intronic
1131412455 15:92221181-92221203 TTGGCAACACTGAAGGTGGTGGG - Intergenic
1132662419 16:1067527-1067549 CAGACACACCTGAAGGTGGTTGG + Intergenic
1134300982 16:12990646-12990668 TTATCAAAACTGGAGGTGGATGG + Intronic
1134504562 16:14794501-14794523 AAGTCAAAACATAAGGTGGTGGG - Intronic
1134576009 16:15334408-15334430 AAGTCAAAACATAAGGTGGTGGG + Intergenic
1140910870 16:79451150-79451172 CCCTGCAAACTGAAGGTGGTGGG - Intergenic
1141330998 16:83110718-83110740 CTGGCAAAACAAAAGCTGGTTGG - Intronic
1141862434 16:86727116-86727138 CTGCCAGAATTGAAGGTGGCTGG + Intergenic
1143329417 17:6122273-6122295 CTGGCCAAACTGAAGGTTGGAGG - Exonic
1144421914 17:15106702-15106724 CTGTGAAGAATGAAGGTGGGTGG - Intergenic
1146004255 17:29150886-29150908 TTGTCAAACATGAAGTTGGTTGG + Intronic
1148639026 17:49171034-49171056 ATGCCCAAACTGAAGGTTGTGGG - Intergenic
1150162316 17:62908728-62908750 CAGTCCAAACTGAAGTGGGTTGG + Intergenic
1151857580 17:76733104-76733126 CTGCCACATCTGCAGGTGGTAGG + Exonic
1155998608 18:32359069-32359091 ATTTCAAAACTGTATGTGGTAGG + Intronic
1156683348 18:39617155-39617177 CTGTTAAAACTGAAGTGGCTAGG + Intergenic
1158590119 18:58772111-58772133 CTGTCACAACTGGAGGTGAGGGG - Intergenic
1158872982 18:61706852-61706874 CTCTGAAGACTGAAGGTGGAAGG - Intergenic
1161322462 19:3647505-3647527 CTGTCAAAACTCAGGGTGGCAGG + Intronic
1161547502 19:4890681-4890703 CTGTCACAACTGCAGGGGATCGG - Exonic
1165921995 19:39305123-39305145 CTGACACAAATGAGGGTGGTTGG + Intergenic
928033823 2:27803377-27803399 ATGTCAAAAATCAAGGTGGCTGG - Intronic
929374342 2:41267079-41267101 CTGCCAAAACTGAAGAGAGTGGG + Intergenic
931368490 2:61640274-61640296 GTGTAAAAACAGAAGGTGTTGGG + Intergenic
931938551 2:67226174-67226196 ATGTCAAAACTGTTGGTGGGCGG - Intergenic
937341367 2:121092971-121092993 TTATCAAAACTGAGAGTGGTTGG + Intergenic
937505833 2:122535418-122535440 CTGTTAAAAATGGAGGTGGGTGG + Intergenic
939795271 2:146635367-146635389 CTGTCAGAAGTCAAGTTGGTAGG - Intergenic
941516175 2:166481943-166481965 CTGTCAAAAATGAAATGGGTTGG + Intronic
944139763 2:196443175-196443197 CTACCAAAACTGAAGGCAGTTGG + Intronic
946456485 2:219830729-219830751 CTGTTAAATCTCAAGGTGCTGGG - Intergenic
946474734 2:219996318-219996340 AGGTGAAAAATGAAGGTGGTTGG - Intergenic
949002582 2:241624877-241624899 CTATGAGAACGGAAGGTGGTCGG + Intronic
1169059496 20:2651522-2651544 ATGTCAAACCTAAATGTGGTTGG - Intergenic
1170324746 20:15144266-15144288 ATGTAAAAACTGCAAGTGGTTGG + Intronic
1170331339 20:15214038-15214060 CTGTCAGAAAAGAAGGGGGTGGG - Intronic
1174437380 20:50519802-50519824 CTTACAAAACTAAAGGTGGGAGG - Intronic
1175134576 20:56813402-56813424 TTGTCACAACTGAAGGTGGGGGG - Intergenic
1175630321 20:60530022-60530044 CTGCCTTAACTCAAGGTGGTCGG + Intergenic
1177901821 21:26926254-26926276 CTGTCTAAACAGAAGGTAGTTGG + Intronic
1179397591 21:41055970-41055992 TTGTCACAACTGAGTGTGGTGGG - Intergenic
1180208876 21:46281523-46281545 CTGTAAAAACAAAAGGGGGTTGG + Intronic
1180749124 22:18111928-18111950 CTGACAAAACTGAAGCTGGAAGG - Intronic
1181958617 22:26606708-26606730 ATGTCAAAACAGCTGGTGGTTGG + Intronic
1184312770 22:43658774-43658796 CTGACAAAACTGAAGATGTGAGG + Intronic
1184452715 22:44592502-44592524 GTGTCAAACCTCAGGGTGGTGGG - Intergenic
1184822477 22:46919899-46919921 CTGTCAACACTGAAGTTGCTGGG - Intronic
1185241113 22:49748278-49748300 CTGTTAAAATTGAGGGTGGGAGG - Intergenic
949861532 3:8509710-8509732 CTGGAAAATCTGAGGGTGGTTGG - Intronic
950076949 3:10194028-10194050 CTGGCAGAACTGAAGGAGGGTGG + Intronic
950934453 3:16824389-16824411 CTAACAAAACTGAAGATGTTGGG + Intronic
951946090 3:28137997-28138019 TTTTGCAAACTGAAGGTGGTTGG + Intergenic
953581796 3:44164129-44164151 CTGTCAAGACTGAACATTGTTGG + Intergenic
953710035 3:45262322-45262344 CAGTCAAAACTTAGGGTGATAGG + Intergenic
953992499 3:47495214-47495236 CTGTGAAGACTGCAGGAGGTGGG - Intergenic
955003140 3:54945675-54945697 CTGTCAAACCTGCATTTGGTGGG - Intronic
955812220 3:62803436-62803458 CTGTCACAACTGGAGGTGAGGGG + Intronic
958546142 3:95553732-95553754 ATATCAGAACTGAAGGGGGTTGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
962404588 3:135089988-135090010 CTGACAAACCTGAAGGCAGTTGG + Intronic
962650646 3:137485904-137485926 CTGTAAAAAATGATGTTGGTTGG + Intergenic
962880658 3:139573528-139573550 CTGTGAGAACTGAAGGGGGTAGG - Intronic
963800350 3:149669958-149669980 CTGTCAATAGTGAAGGAGGAGGG + Intronic
963929043 3:150982840-150982862 CTATCAGAACTGAAGGGGGCTGG + Intergenic
964052365 3:152411223-152411245 CTATCAAAACTGAAGATGGCTGG + Intronic
964119387 3:153166449-153166471 CTGTCAAAACAGAAATTGGGTGG + Exonic
965536478 3:169828780-169828802 CTTTCAAAACTGAAGATACTTGG + Exonic
967475712 3:189914989-189915011 CTTGCAAAACTGAATGTGGGTGG - Intergenic
967600257 3:191378474-191378496 ATGGCAAAAGTGAAGGAGGTAGG + Intronic
968006571 3:195247244-195247266 CTGTGAAATCTGAGGGTGGTCGG + Intronic
968494544 4:908035-908057 GTGTGAAAACTGAAGCTGCTCGG - Intronic
970166919 4:13248367-13248389 CTGTCAAAACTGAACATTTTAGG + Intergenic
970921909 4:21404228-21404250 CTATGAAAAATGAAGCTGGTGGG - Intronic
971582361 4:28358211-28358233 CTGTCAAGAGTGCTGGTGGTGGG - Intergenic
973112369 4:46412051-46412073 GTGGGAAAACTGAAGGTTGTTGG + Intronic
974782967 4:66577695-66577717 CTGTAAAAACTATAGGTGGCAGG + Intergenic
978498335 4:109384038-109384060 CTGCCAACACAGAAGGGGGTGGG - Intergenic
980209389 4:129766211-129766233 CTGTCAAGAGTTAAGGAGGTGGG + Intergenic
981328042 4:143474757-143474779 CTGGCAAGTCTGAAGTTGGTAGG - Intergenic
983442834 4:167809510-167809532 CTGACAACTCTGGAGGTGGTGGG - Intergenic
983916246 4:173294911-173294933 CTTTCAACACTGATTGTGGTTGG + Intronic
984020661 4:174481137-174481159 CTGTGAAAACTGATCTTGGTAGG - Intergenic
985761422 5:1751226-1751248 CAGTCAAGGCTGGAGGTGGTAGG - Intergenic
987143089 5:14965193-14965215 TTGTAAAAACTAAAGGTGGCCGG - Intergenic
988854298 5:35212758-35212780 CTCTCAAAACTGAGGGTGGGAGG + Intronic
990304586 5:54481916-54481938 CTGTCACATCTGAAGGGGCTGGG - Intergenic
992307026 5:75451084-75451106 CTATAAAAACTAAAGGGGGTTGG + Intronic
993065885 5:83096359-83096381 CTGCCAAGACTGATGTTGGTGGG + Intronic
993997075 5:94735954-94735976 CTGTCCAAACCCAAGGTGATTGG - Intronic
994382412 5:99087064-99087086 ATGACAAAACTGGAGTTGGTAGG + Intergenic
994808625 5:104484102-104484124 CTTTCAAAACTGAAAGTCATTGG - Intergenic
995448202 5:112270240-112270262 CTGAGAAAACTGAAGGATGTAGG + Intronic
1003025717 6:2553837-2553859 CTATCAAAACTGATCATGGTTGG - Intergenic
1003367283 6:5487005-5487027 CTGACAGAAATGAAGCTGGTTGG + Intronic
1003673730 6:8183302-8183324 CTTCCAAAACTGAGGGTGGGTGG - Intergenic
1003954710 6:11151013-11151035 CTGTGAAAAGAGGAGGTGGTGGG - Intergenic
1003966524 6:11257279-11257301 CTGTCAAAACTGAAGGTGGTGGG - Intronic
1004735510 6:18402263-18402285 CTGTGTAAAATGAAGGTGCTAGG + Intronic
1005429151 6:25736096-25736118 CTGTTGAAAGAGAAGGTGGTGGG + Intergenic
1006438400 6:34038855-34038877 ATGTCCTAACTGAAGGTGGCAGG - Intronic
1007330559 6:41103862-41103884 CGGTCAAGACTGAAGATTGTTGG + Intergenic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1009493638 6:64324032-64324054 CTGTCAAAAGTTAGGGTGATGGG - Intronic
1012720901 6:102743146-102743168 GTTGCAAAACTGAAGGTGGATGG + Intergenic
1012974681 6:105767790-105767812 CTGTGAAAGAGGAAGGTGGTTGG - Intergenic
1013712092 6:112913592-112913614 GTGACAAAACTGAATGAGGTAGG + Intergenic
1014908422 6:127059265-127059287 ATATCAAAACTGAAGGGGGTTGG + Intergenic
1016392103 6:143585035-143585057 CTGTCATAACTCAAGTTGTTGGG + Intronic
1016497070 6:144675561-144675583 CTGTCATAACTTGAGTTGGTTGG + Intronic
1017042761 6:150320885-150320907 CTGTTAATTCTGAAGTTGGTTGG - Intergenic
1017486669 6:154908746-154908768 CTGTCAAAAATTAAAGTGCTTGG + Intronic
1017766337 6:157610087-157610109 CTGTGAATATTTAAGGTGGTTGG - Intronic
1018795850 6:167185086-167185108 TTGTCACAACTGGGGGTGGTGGG + Intronic
1018820468 6:167369978-167370000 TTGTCACAACTGGGGGTGGTGGG - Intronic
1019579239 7:1751807-1751829 CGCTCAAGACTGAAGGTGGCCGG + Intergenic
1022250282 7:28600502-28600524 ATGTGAAAACTGAGGATGGTAGG + Intronic
1023529408 7:41136986-41137008 CTGTCAACTCGGAAGGGGGTGGG + Intergenic
1026185786 7:68081864-68081886 CTGTGAAGAGAGAAGGTGGTGGG + Intergenic
1026448711 7:70508260-70508282 CTGTCAAAAAGGAGGGGGGTAGG + Intronic
1029236978 7:99128675-99128697 CTTTCTAAACTGAATGTGCTGGG + Intronic
1036943984 8:13077169-13077191 CTTTTAAAACTGAAGGCTGTGGG - Intergenic
1037407128 8:18554864-18554886 CTGTCAGAAATGAAGATGATGGG + Intronic
1038311272 8:26448287-26448309 CTGTAAGATCTGAAGGGGGTGGG + Intronic
1039779445 8:40770026-40770048 CTGCCAAAACTGGAGGTGGGGGG - Intronic
1041704894 8:60836189-60836211 CTGCCAAAACTGAAGGCTGGTGG + Exonic
1041938553 8:63361257-63361279 CTGTCACCACTGAACGTGGATGG + Intergenic
1047803325 8:128332513-128332535 CTGACAAAACTGAAGGATGTAGG - Intergenic
1049133418 8:140870954-140870976 CTGTTACAACTGAAGAGGGTGGG + Intronic
1050630755 9:7555865-7555887 CTGTAAAAACTGAAGTGGGAGGG + Intergenic
1050796066 9:9543978-9544000 CTTACAAAATTGAAGGTGGAGGG - Intronic
1054743688 9:68833511-68833533 CTGTCAGAACTGAGGGGAGTAGG + Intronic
1055779139 9:79800354-79800376 CTGTGGAAGCTGATGGTGGTGGG + Intergenic
1058505154 9:105659310-105659332 CTTCCAAAACTGAAAGGGGTGGG - Intergenic
1058954686 9:109934684-109934706 CTTTCAAAACTGAAGCTGAAAGG - Intronic
1059794560 9:117678477-117678499 CAGTTAAAACTGAATGTGGGTGG - Intergenic
1203793313 EBV:163029-163051 CTGGCAAAACTGCAGGTAGTAGG + Intergenic
1186348274 X:8716967-8716989 TTGTCATGACTGAAGGTGGGAGG + Intronic
1189769481 X:44409549-44409571 ATGGCAAAACAGAAGCTGGTAGG - Intergenic
1191129153 X:56989791-56989813 CTGTCCCAAATGAGGGTGGTGGG - Intronic
1193158666 X:78203014-78203036 TTGTCAACAGTGTAGGTGGTTGG - Intergenic
1193587728 X:83346569-83346591 CTGTATAAAATGAAGGTAGTAGG - Intergenic
1193912684 X:87325279-87325301 ATTTCAAAACTGAAGGAGGTGGG + Intergenic
1194801196 X:98275468-98275490 CTGTGAAAAATGATGCTGGTAGG - Intergenic
1194939034 X:99987225-99987247 CAGCCAAGACTGAAGGTGGTAGG + Intergenic
1195964971 X:110421823-110421845 CTGTCACACCTCAAGGTGGTTGG - Intronic
1196630685 X:117936021-117936043 TTTTAAAAACTGAAGGTGCTAGG + Intronic
1196806298 X:119589910-119589932 CTGTCAAATATGAAGCTGCTGGG - Exonic
1198141781 X:133811394-133811416 CTGTCCCAACTGAAATTGGTGGG + Intronic
1199973598 X:152878112-152878134 CTCTAAACACTGAAGGTGGAAGG - Intergenic