ID: 1003968999

View in Genome Browser
Species Human (GRCh38)
Location 6:11280477-11280499
Sequence CACCCAGTCCTCCCCATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003968999_1003969002 -3 Left 1003968999 6:11280477-11280499 CCCACCATGGGGAGGACTGGGTG 0: 1
1: 0
2: 1
3: 20
4: 172
Right 1003969002 6:11280497-11280519 GTGTCTTCCATTTGCTCCTCCGG 0: 1
1: 0
2: 0
3: 15
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003968999 Original CRISPR CACCCAGTCCTCCCCATGGT GGG (reversed) Intronic
902261278 1:15226597-15226619 CATCCACTCCTCTTCATGGTGGG - Intergenic
902895430 1:19476542-19476564 CACCCAATAGTCCCCATGGAGGG + Intronic
904576949 1:31511051-31511073 CACCCACTCCTCCAAATGGATGG - Intergenic
906249940 1:44303192-44303214 CACCCAGTACTCACCATGGAGGG + Intronic
911267282 1:95756958-95756980 GACCCTGTCCTCCACATGTTAGG - Intergenic
913210609 1:116579468-116579490 CAGCCACTCCTCCACATGGCAGG + Exonic
917268679 1:173249533-173249555 CACCCAGTACACCACAGGGTGGG + Intergenic
918161653 1:181906538-181906560 CACCCAGGAGTCCCCATGGCAGG + Intergenic
918693533 1:187512584-187512606 TACCCTGTTCTCCCCATGGTTGG - Intergenic
921417973 1:214912553-214912575 CTCCCAATCCACCCCATGATGGG + Intergenic
921485819 1:215714386-215714408 TACCCAGGTGTCCCCATGGTTGG - Intronic
922462593 1:225824708-225824730 CCCTCCGTCCTCCCCAGGGTGGG + Intronic
922749061 1:228062352-228062374 CCCCCAGTGTGCCCCATGGTAGG + Intergenic
923361084 1:233211698-233211720 CATGCATGCCTCCCCATGGTTGG - Intronic
924772341 1:247088764-247088786 GTCCCCTTCCTCCCCATGGTGGG + Intergenic
1063299638 10:4840146-4840168 TCCCCAGGCCTCTCCATGGTTGG + Intronic
1064600370 10:16986409-16986431 CACACACTCCTCCCCAAAGTAGG - Intronic
1065803162 10:29370885-29370907 AACCCAGACCTCCTAATGGTGGG - Intergenic
1067757125 10:49013670-49013692 CTCCCAATCCTCCCCTTTGTGGG - Intergenic
1069712909 10:70501206-70501228 CACACAGTCCTCCCCACAATTGG - Intronic
1072443412 10:95477318-95477340 CACCCAGCCCTGCCCTGGGTGGG + Intronic
1076468598 10:130702921-130702943 CACTCAGTCCTCCTCAGGGGGGG - Intergenic
1077434536 11:2532478-2532500 CACTCAGTCATGGCCATGGTGGG + Intronic
1077996004 11:7453264-7453286 TACCCACTCCTCCCCATAGTGGG - Intronic
1078277580 11:9864881-9864903 CTCCCAATCCTCCCCATTTTTGG + Intronic
1078947423 11:16085251-16085273 CAACCAGTCCTCACCATACTGGG - Intronic
1079366419 11:19814055-19814077 CACCCAGCCCTCACCCTGGGCGG - Intronic
1080628230 11:34050934-34050956 CACCCACTCCACCCCAAGGCTGG + Intergenic
1080876186 11:36276482-36276504 CACCCAGCCCTCCAGATGTTAGG + Intronic
1091696815 12:2633329-2633351 CACCCACTCCTGCCCCTGGTGGG + Intronic
1104814402 12:131637572-131637594 CAGCAAGTGCTCCCCATGGGAGG + Intergenic
1108224577 13:48275091-48275113 GAGCCAGTCCTCCCCATCCTTGG - Intergenic
1108493650 13:51004484-51004506 CATCCAGTCCTTCACATGATGGG - Intergenic
1113643707 13:111976683-111976705 CACCCAGGCCGCGCCCTGGTTGG - Intergenic
1113982488 13:114288223-114288245 CAACCTGTCATCCCGATGGTAGG - Intronic
1115502553 14:34062498-34062520 CACCCAGCCCGCCCCAGGGTGGG - Intronic
1119767720 14:77200766-77200788 TGCCCTGTCCTCCACATGGTAGG + Intronic
1122079682 14:99257970-99257992 CACCAGGTCCTCCCCGGGGTTGG + Intronic
1123945259 15:25235842-25235864 CACCCCATTCTCCCCATGGAGGG + Intergenic
1124140454 15:27072728-27072750 CCCCCCTTCCTCCTCATGGTGGG - Intronic
1124372255 15:29110504-29110526 CCCCCAGGCCACCCCATGGTGGG - Intronic
1126015712 15:44348396-44348418 TACCCTGGCCTCCCCATGGGAGG + Intronic
1127041672 15:54983940-54983962 CCCCCAGATCTCCCCATGGCTGG + Intergenic
1127673718 15:61220489-61220511 CAGCCACTCCTCCCCATGACTGG + Intronic
1127782511 15:62329624-62329646 CACCCAACCCTCCCCATCTTTGG + Intergenic
1129091566 15:73156837-73156859 TACTCAGGCCTCCCAATGGTGGG + Intronic
1129789915 15:78334119-78334141 CACCCTGTCCTCCCAGTGTTGGG + Intergenic
1132648626 16:1010455-1010477 CAGCAAGTCCTCCCCATGGCTGG + Intergenic
1132816783 16:1832816-1832838 CCCCCAGTTCTCCCCAAGGGAGG + Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133981281 16:10635049-10635071 CACTCTGTTCTCCCCATGCTAGG - Intronic
1136227520 16:28869046-28869068 CACCCAGGCCTTCACATGCTGGG - Exonic
1136584766 16:31177353-31177375 CATCCAGTCGGCCCCATGATTGG + Intergenic
1138327769 16:56190625-56190647 CACCCTGGCCTCCCCAGGGTGGG + Intergenic
1141855997 16:86681862-86681884 CACCCAGTCCTCCAACTGGGGGG + Intergenic
1143409376 17:6699377-6699399 CACTCTGTCCTGCCCATGGACGG - Intronic
1145399203 17:22517410-22517432 CCCCCAGTCCTCTCCCTGCTGGG + Intergenic
1146599860 17:34204959-34204981 CACGGAGTCCTCCCCATCGCCGG + Intergenic
1147186014 17:38713420-38713442 CAACCTGCCCTCCCCATGGGAGG + Intronic
1147245146 17:39115407-39115429 GAGCCAGTCCTCCCCCTGGCAGG - Intronic
1147615304 17:41823801-41823823 CACCCCGTCCTCACAATGCTCGG - Intergenic
1147635527 17:41961653-41961675 CAGACAGTCCAGCCCATGGTGGG - Intronic
1148241567 17:46002510-46002532 CAACCAGGCCCCCCCATGCTTGG - Intronic
1148999350 17:51741168-51741190 CACCCAGTCATGCCCATAGGTGG - Intronic
1150493771 17:65592261-65592283 CACCCAGCCTTCCCACTGGTTGG + Intronic
1151811028 17:76442002-76442024 CACCCAGTCCTCACCTTAGGAGG - Intronic
1152020643 17:77778641-77778663 CACCCACTCCTCCCCACAGCAGG - Intergenic
1152041533 17:77906755-77906777 CACCCAATCCCCCGCATGGCTGG - Intergenic
1152070791 17:78132687-78132709 TGCCCAGGCCTCCCCAGGGTTGG + Intronic
1152399808 17:80059113-80059135 CATCGGGCCCTCCCCATGGTGGG + Intronic
1152495705 17:80669736-80669758 CCCCCAGACCTCTCCATGGAGGG + Intronic
1153187370 18:2500401-2500423 CACCCCGTCCTCTCCCTGCTGGG - Intergenic
1157530065 18:48412634-48412656 CACCCAGTCTGCCTTATGGTAGG - Intergenic
1157731783 18:50010380-50010402 CACCCAGCCCACCCCATCGTGGG + Intronic
1160693757 19:472598-472620 CCCCCAATCCTCACCATGGAGGG - Intronic
1161105099 19:2439572-2439594 CACCCAGTTGTCCCCATCCTGGG - Intronic
1162779098 19:12997322-12997344 CACGCAGGCCTGCCCATGGCCGG - Intronic
1163456908 19:17412148-17412170 CACTCAGTTCTCCCCAGGGCAGG - Intronic
1165230010 19:34381007-34381029 CACCCAGCCCTTCCCATGTGTGG - Intronic
1166266721 19:41688933-41688955 CACCCCGCCTTCCCCATGGGTGG + Intronic
1166302949 19:41922484-41922506 CACCCACTTCTCCCCATTTTTGG - Intronic
1166571037 19:43797604-43797626 CTCCCAGTCCTCCTGCTGGTGGG - Exonic
1167158818 19:47754950-47754972 CACCCAGGGCAGCCCATGGTGGG - Intronic
1167437809 19:49490050-49490072 CAGCCACTCTTCCCCAGGGTTGG + Intronic
1167439722 19:49501050-49501072 CACCCACTCCACCCTATGCTGGG + Intergenic
1167666779 19:50826942-50826964 CACACAGGCCTCCCCCGGGTGGG + Exonic
925411837 2:3644009-3644031 CACGCAGTCCTCCTCGTCGTAGG - Exonic
930037327 2:47094914-47094936 CACACACTCCTCCCCAGGGCTGG + Intronic
932055253 2:68436968-68436990 AACCCACTCCTCCCAATGGCAGG - Intergenic
933764469 2:85697405-85697427 CACCCAGTACTCCCATTGCTAGG + Intronic
934167129 2:89304373-89304395 CACTCTGGCCTCCCCATGCTGGG + Intergenic
934200149 2:89878071-89878093 CACTCTGGCCTCCCCATGCTGGG - Intergenic
935344236 2:102090214-102090236 CACCCAAAACTCCCCATGGTAGG - Intronic
936009721 2:108917810-108917832 CACCCATTGCTGCCCAAGGTTGG - Intronic
936492335 2:112983095-112983117 CACCCAGTCCTCCTCAAGCAGGG + Intronic
937022249 2:118668373-118668395 CTCCAAGTCCCCCCCATTGTTGG - Intergenic
938145346 2:128830253-128830275 CACACTGTCTTCCACATGGTTGG - Intergenic
941635394 2:167930329-167930351 CACCCGGGACTCCCCATTGTGGG + Intergenic
942219945 2:173759379-173759401 TTCCCAGTCCTACCCATGGCAGG + Intergenic
943368119 2:186984247-186984269 CACCTAGTCTTACCCATTGTGGG + Intergenic
944664137 2:201945630-201945652 CACCCAGGTCTTCCCATGGCTGG + Intergenic
945959395 2:216116555-216116577 CAACCAGACCTCCCTATGGCAGG - Intronic
947804813 2:232958876-232958898 CACCCACTCCTCCCCAGGCCTGG + Intronic
947841096 2:233208475-233208497 CACTCAGTCCTGCCCCTGCTGGG - Intergenic
948023162 2:234753964-234753986 CAGCCAGGCAGCCCCATGGTCGG + Intergenic
948518767 2:238522680-238522702 CGCCCATTCCTCCCTCTGGTGGG + Intergenic
948524211 2:238560309-238560331 CTCCCAGTCCCTCCCATGCTGGG - Intergenic
948622012 2:239241317-239241339 CACCTAGTCCTGCCCAGGTTGGG + Intronic
1170065112 20:12302771-12302793 GACCCAGTGTTCCACATGGTTGG + Intergenic
1173727815 20:45309136-45309158 CACCCTGCCTTCCCCAGGGTGGG + Intronic
1174045159 20:47728036-47728058 CACCCAGCCTTCCCCACTGTGGG - Intronic
1174227978 20:49020220-49020242 CACCCTGTCCTCAACATGCTAGG + Intronic
1175608565 20:60331327-60331349 AACCCTGGCCTCCCCAGGGTGGG - Intergenic
1175632403 20:60552722-60552744 CACCCAATCCTGCACAGGGTGGG + Intergenic
1178430724 21:32516595-32516617 CACCCAGCCCTCCCCAAGTGGGG - Intergenic
1180934903 22:19619027-19619049 CACTCCTTCCTCCCCGTGGTGGG + Intergenic
1181067385 22:20313331-20313353 CTCCCAGCCCTGCCAATGGTGGG + Intergenic
1181377870 22:22474860-22474882 CACCTAGGCCTCCCCATGACAGG + Intergenic
1184638474 22:45855410-45855432 CAGACAGTCCACCCCAGGGTAGG - Intergenic
1184692471 22:46123549-46123571 CACCCAGCCGTCACCATGCTGGG - Intergenic
1185018936 22:48362307-48362329 CACCCTGTGCTCCCCAGGGCAGG + Intergenic
949954523 3:9256669-9256691 CATCCACTCCTCCCCAGGGGAGG + Intronic
955767532 3:62360462-62360484 CTTCCACTCCTCCCCATGGGTGG - Intergenic
956146362 3:66194967-66194989 CACCCACTCCTCCCCTTGGTGGG + Intronic
962164870 3:133038458-133038480 CCCCCAGTCCTTCCCATGCTGGG + Intronic
963981486 3:151543232-151543254 GACCCACTCCTCCCCTTGGACGG - Intergenic
967956246 3:194879962-194879984 AACACAGTCCTCCCCATGAGGGG - Intergenic
968793809 4:2688515-2688537 CACACAGGCCTCCCCTTGGCCGG - Intronic
969448186 4:7257325-7257347 CACACAGCCTTCCCCAAGGTCGG - Intronic
972817106 4:42656848-42656870 GACACGGTCCTCCGCATGGTGGG + Exonic
975228200 4:71899342-71899364 CACCCACTCCTCCCAATGCACGG - Intergenic
980989710 4:139728790-139728812 CACCCTGTGCTCCCCAGGGTCGG + Intronic
983474059 4:168193345-168193367 TTCTCAGTCCTCCCCATGATTGG - Intergenic
984950969 4:185007528-185007550 CACTTAGTCCTCCCAATGGTGGG - Intergenic
985710831 5:1428697-1428719 CACCCAGTGTTCCTCAGGGTTGG - Intronic
985838206 5:2285979-2286001 CACCCAGCTTCCCCCATGGTAGG + Intergenic
987113344 5:14707621-14707643 CTCCCAGGCCTCCCCATCCTGGG + Exonic
990473493 5:56139821-56139843 CACCCAGGCCTCCCAAGTGTCGG - Intronic
991298094 5:65102654-65102676 CACGGATTCCTCCCCATGGTGGG - Intergenic
992432417 5:76722205-76722227 CACCAATTCCTCCCCAGGGCTGG - Intronic
994384538 5:99114239-99114261 CACCAAGTACTTCACATGGTAGG - Intergenic
995027889 5:107445667-107445689 CACCCAGACCTCTCCAAGGATGG + Intronic
995180893 5:109229246-109229268 CAGACTGTCCTCCCCATTGTGGG - Intergenic
997385372 5:133468158-133468180 CCCCCAGCCTTCCCCATGGTGGG - Intronic
998486403 5:142506272-142506294 CACACAGTCCCCACCATGGAAGG - Intergenic
1001461504 5:171919051-171919073 CATCCTGACCTCGCCATGGTAGG + Intronic
1001717149 5:173825507-173825529 CAACCAGTCCTCCCCCAGGCTGG - Intergenic
1002382898 5:178842886-178842908 CAGCAAGTCCTCCCCAAGGAGGG + Intergenic
1003224559 6:4191874-4191896 CAAGCAGTCATCCCCATGGCAGG - Intergenic
1003677088 6:8215248-8215270 CACCCAATCCTGCTCATGTTTGG + Intergenic
1003968999 6:11280477-11280499 CACCCAGTCCTCCCCATGGTGGG - Intronic
1004655531 6:17656313-17656335 CACCCAGTCCTTCCCATCACTGG - Intronic
1006107229 6:31723969-31723991 CCCCCGGGCCTACCCATGGTAGG + Exonic
1013272891 6:108559726-108559748 CGCCCAGCCCTCCCCCTGGGCGG + Intergenic
1013465217 6:110412010-110412032 CTCCCAATCCTCCCACTGGTGGG - Intronic
1017525741 6:155240127-155240149 CACCCAGTCCCCTCAATGGTTGG - Intronic
1018028500 6:159823552-159823574 AAGCCAGTGCTCCCCATGGCTGG + Intergenic
1018707682 6:166475053-166475075 CACCGAGTCCTCCACCTGGGAGG + Intronic
1019746832 7:2705530-2705552 AATCCACTCCTCCCCATCGTGGG + Intronic
1023994551 7:45151311-45151333 CACTCTGTTCTCCCCCTGGTAGG + Intergenic
1028063823 7:86355801-86355823 CACCAAGTCCTTCCCACAGTGGG + Intergenic
1031540516 7:122989464-122989486 CATCCAGACCTGCCCAGGGTAGG - Intergenic
1034265077 7:149776858-149776880 TCCCCAGGCCTCCCCAGGGTGGG + Intergenic
1035366172 7:158350312-158350334 CAGCCAGTCCTGCCCCTGCTTGG - Intronic
1035392631 7:158515574-158515596 CACCCACTGCTCCCAATGGGAGG + Intronic
1035625194 8:1066310-1066332 CGCTCAGACCTGCCCATGGTGGG - Intergenic
1035625225 8:1066442-1066464 CACCCAGACCTGCCCAAGGTGGG - Intergenic
1035625255 8:1066582-1066604 CACTCAGACCTGACCATGGTGGG - Intergenic
1035625271 8:1066648-1066670 CACTCAGACCTGCCCATGGTGGG - Intergenic
1036192456 8:6682665-6682687 TAGCCAGTCTTCCCCATGGCAGG + Intergenic
1038437084 8:27543810-27543832 CACCCAGTCCTCCATGTGCTGGG - Exonic
1039247319 8:35623221-35623243 GACCAAGTCCTCCCCAGGCTTGG - Intronic
1041621006 8:59969424-59969446 CAGTCACTCCTCTCCATGGTAGG + Intergenic
1044739903 8:95315473-95315495 CACCCAGCCAGCCCCAAGGTTGG - Intergenic
1045950083 8:107841584-107841606 CCCCCAGTTCTCCCAATGATAGG + Intergenic
1047177172 8:122553014-122553036 CAACCCGTCCTCTCCAGGGTGGG - Intergenic
1047247939 8:123160739-123160761 CACCCAGACCTGCCCAGGGAAGG + Intergenic
1049683570 8:143930427-143930449 CACCCAGCCCACCCCATGCGGGG - Exonic
1059503277 9:114775152-114775174 CCCCCACCCCTCCCCTTGGTGGG + Intergenic
1060113070 9:120920300-120920322 CACTCAGAGCTCCCCAGGGTAGG + Intronic
1061099946 9:128484916-128484938 CACCCAGCCCTCCTCAGGGCAGG - Intronic
1061195224 9:129103620-129103642 CAGCCACTGGTCCCCATGGTGGG - Intronic
1061782644 9:133004853-133004875 CACCCAGGCCTCCCCAGAGGAGG - Intergenic
1062326057 9:136013125-136013147 CACCCAGTCCTCCTCAGGCTGGG + Intronic
1187505536 X:19875542-19875564 CACCCACTCCTCCACAGGGCAGG + Intronic
1188406867 X:29821945-29821967 CACCCAGTCTTCCACAATGTGGG + Intronic
1188981793 X:36733471-36733493 TACCCAGTCCTCCCCCTGTTTGG + Intergenic
1189998537 X:46662724-46662746 CACCCAGTCCCACCCAAGATAGG - Intronic
1190485056 X:50915874-50915896 CACCCAGGGCTCCACATGGCAGG - Exonic
1192299345 X:69883585-69883607 CTCCCAATCTTCCCCATGATGGG + Intronic
1194193549 X:90865517-90865539 CACTTAGTCCTCCCCATTGCTGG + Intergenic
1196778123 X:119359708-119359730 ATCCCAGTCCTCCCCAGGATGGG - Intergenic
1200133070 X:153862049-153862071 CGCCCAGCCCACCCCATGGCCGG - Exonic
1200540161 Y:4447904-4447926 CACTTAGTCCTCCCCATTGCTGG + Intergenic