ID: 1003972173

View in Genome Browser
Species Human (GRCh38)
Location 6:11310306-11310328
Sequence CAGTGGGCAGAGAGGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 898
Summary {0: 1, 1: 0, 2: 1, 3: 98, 4: 798}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003972173 Original CRISPR CAGTGGGCAGAGAGGGAAGT GGG (reversed) Intronic
901029639 1:6299490-6299512 CAGAGGGCATAGAGGACAGTCGG + Intronic
901029650 1:6299537-6299559 CAGAGGGCACAGAGGACAGTCGG + Intronic
901489608 1:9589805-9589827 CAGAGGGCAGGGGGGAAAGTGGG + Intronic
901739607 1:11333739-11333761 AGGGGGGCAGGGAGGGAAGTGGG + Intergenic
902337307 1:15760907-15760929 CAGTGGGACGGGAGGGAAGCCGG + Intronic
903360824 1:22775976-22775998 AAGTTGGCAGAGTGGGAGGTGGG + Intronic
903583466 1:24390071-24390093 CAGATGGCAGAGAGGGAATGAGG - Intronic
903827856 1:26158352-26158374 GTGTGGGCAGAGAAGGAAGCGGG + Intergenic
903956868 1:27031864-27031886 AAGTGGGGAGAGACGGAAGGAGG - Intergenic
903996482 1:27308065-27308087 CAGGGGGCAGGGAGGGAGGGTGG - Exonic
904001757 1:27342801-27342823 CAGGGCACAGAGAGGGACGTGGG + Intronic
905030160 1:34876880-34876902 CAGTGGATACAGAGAGAAGTGGG - Intronic
905106350 1:35565690-35565712 GGGCGGGCAGAGAGGGAAGGAGG + Exonic
905289379 1:36911113-36911135 CACTGGGGAGAGAGGGAGGGAGG + Intronic
905592170 1:39173604-39173626 CTCTGGGCAGGGAGGGAAGAGGG + Intronic
905876379 1:41434390-41434412 CAGTGGGCAGTCAAGGAAGGAGG - Intergenic
906155599 1:43612261-43612283 CAGTGAGCAGCGTGGCAAGTGGG + Intronic
906353544 1:45083867-45083889 CAGGAGGAAGAGAGAGAAGTGGG + Intronic
906832120 1:49044189-49044211 CAAGAGGAAGAGAGGGAAGTAGG + Intronic
906944783 1:50286428-50286450 CAGTGGGTAGAGTGGAAGGTAGG - Intergenic
907407107 1:54260395-54260417 CAGTGGTCAGGGAGGGCAGGAGG + Intronic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
908979803 1:69942117-69942139 GAGTGGGCACAGTGGGCAGTAGG + Intronic
909382046 1:75009878-75009900 CAGGAGGAAGAGAGAGAAGTAGG - Intergenic
909706919 1:78596517-78596539 CAGGAGGCAGAGTGGGAAGAGGG - Intergenic
909837891 1:80280360-80280382 GATTGGGCAGAGGGAGAAGTTGG + Intergenic
909971197 1:81992127-81992149 CAGAGGGCAAAGAGGGCACTGGG + Exonic
910224542 1:84923030-84923052 CAATGGGTTGAGAAGGAAGTGGG + Intergenic
910611181 1:89144015-89144037 GAGGAGGCAGGGAGGGAAGTAGG - Intronic
911086512 1:93982232-93982254 GAGGGGGCAGGGAGGGAAGGGGG - Intergenic
911358090 1:96846003-96846025 GAGGGGGAGGAGAGGGAAGTGGG - Intergenic
911380101 1:97104035-97104057 CACTGGGCAGGGAGGGTAATCGG - Intronic
912121059 1:106472890-106472912 CAGTGGGCAAGGTGGCAAGTGGG + Intergenic
912364033 1:109118216-109118238 CAGTAGGCAGAGATGGAGGAAGG + Intronic
912697027 1:111849400-111849422 CAGGGGGCAGAGAGGAAGATGGG - Intronic
912947110 1:114094479-114094501 CTCTGGGCTGAGAGGGAAGGGGG + Intronic
913093947 1:115498559-115498581 GAGTGGGCAGAGACAGGAGTGGG + Intergenic
913163873 1:116168110-116168132 CAGTGGGCGGGGAGAGAAGAAGG + Intergenic
913367369 1:118055115-118055137 CTGTGGGCAGAAGGGGAAGATGG - Intronic
913454238 1:119014838-119014860 CAGGGGTCAGAGATGGATGTGGG - Intergenic
914682616 1:149949835-149949857 CAGTTGGCAGAGTGGGATGTAGG - Intronic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
915164387 1:153940556-153940578 CAGCGGGCACAGAGGAATGTAGG + Exonic
915227739 1:154423161-154423183 CAGTGGGCACTGAGGGATGTCGG - Intronic
915507754 1:156368242-156368264 CAGTGGGCACACAGGGAACCTGG + Intergenic
915541089 1:156566679-156566701 CAATGGGCAGAGAAGGGAGTTGG - Intronic
915730810 1:158052882-158052904 CAGAAGGCAGAGAGGGGAGCTGG + Intronic
915848205 1:159291630-159291652 CAGTAAGCAGAGAGGGAATAAGG - Intronic
915986717 1:160473361-160473383 CAGTAGCTAGAGAGAGAAGTGGG + Intergenic
916577545 1:166081088-166081110 AAGTGGGCGGAGGGGAAAGTGGG - Intronic
916699090 1:167272601-167272623 CAGGAGGAAGAGAGAGAAGTAGG + Intronic
917139269 1:171818489-171818511 GAGTGGGAGGAGAGTGAAGTGGG - Intergenic
917711248 1:177687602-177687624 CTGTGGGAAGTGAGGGAGGTAGG + Intergenic
918081805 1:181213614-181213636 CTGTGGTCTGAGAGGGAAGAAGG + Intergenic
918177937 1:182061495-182061517 CGGTGAGCAGAGAAGAAAGTAGG - Intronic
918522954 1:185434965-185434987 GAGAGGGAAGAGAGGGAAGAGGG - Intergenic
918742754 1:188156053-188156075 CATGGGGCAGTGAGGGAAGAAGG + Intergenic
919579151 1:199349615-199349637 CAGCAGGAAGAGAGTGAAGTGGG - Intergenic
919642559 1:200059578-200059600 CAGTGTGCAGACAGGGAACAGGG - Intronic
919982483 1:202650962-202650984 CACTGGGCAGAGTGGGAAGAAGG + Intronic
920498803 1:206473394-206473416 CAGTGGGCATTGAGGGTGGTGGG + Intronic
920827465 1:209435255-209435277 CAGTGGGGAGTAAGGGAATTTGG - Intergenic
920933204 1:210407934-210407956 CAGTGGTCAAATAGGGAATTTGG + Intronic
921095299 1:211882069-211882091 GAGTGGGGAGAGAGGGATGGGGG - Intergenic
921308142 1:213817306-213817328 CAGAGGCCAGAGAAGGAAGGCGG + Intergenic
921440113 1:215175641-215175663 GAGTGGGAAGGGAGGGAAGGGGG - Intronic
921502567 1:215923648-215923670 CAGGGTGCTGAGAGGGAAATTGG + Intronic
921602883 1:217125149-217125171 CACTGGGGAGGGAGGGCAGTGGG + Intronic
921825936 1:219671953-219671975 CAGTTTGCATAGAGGGAAGCAGG - Intergenic
921890975 1:220353299-220353321 TAGTGGGCAGAGACAGAAGTGGG + Intergenic
921991798 1:221374779-221374801 CTGTTGGCACAGAAGGAAGTGGG - Intergenic
923265600 1:232310844-232310866 CAGTGGGTAGATAAGGAGGTGGG + Intergenic
923387907 1:233483961-233483983 CACTGGGTGGAGAGGGATGTGGG - Intergenic
924352271 1:243127419-243127441 CATTGGGCAGAGTAGGGAGTTGG + Intronic
924464842 1:244290617-244290639 CAGTGGGTAGGGAGGAAAGAAGG + Intergenic
924783485 1:247172866-247172888 CAGTGCCCAGAGAGAGAAGTGGG + Intergenic
924937839 1:248787385-248787407 CAGTGGCCAGGGATGGCAGTTGG - Intergenic
1063020561 10:2122970-2122992 CAGTGGTCAGTAAGGTAAGTTGG - Intergenic
1063645392 10:7877005-7877027 TAGTGAGCAGATAGGAAAGTGGG - Intronic
1063967672 10:11359488-11359510 CAGCAGGCAGAGTGGGAAGCGGG - Intergenic
1064183829 10:13143006-13143028 CAGTGAGGAGAGAGGGACATGGG - Intergenic
1064291956 10:14043430-14043452 CAGTGGGCAGGGAGTGAAATTGG - Intronic
1064314030 10:14238002-14238024 CACTGAGCAGAGAGGCAGGTGGG - Intronic
1065438589 10:25726554-25726576 AAGTGGGGAGAGAGGAAAGAAGG - Intergenic
1067143778 10:43678801-43678823 TGGTGGGCAGACAGGGAAGATGG - Intergenic
1067395903 10:45917112-45917134 CATTGGTCACATAGGGAAGTAGG - Intergenic
1067521512 10:47010619-47010641 CAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1067864227 10:49886237-49886259 CATTGGTCACATAGGGAAGTAGG - Intronic
1067921944 10:50468007-50468029 CAGAGGGGAGAGAAGGGAGTGGG + Intronic
1067928134 10:50531715-50531737 CAGTGGGCAGGTAGGGAAGGTGG - Intronic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1068881702 10:62056186-62056208 CTGTAGGCAGACAGGGAACTTGG - Intronic
1069190414 10:65480211-65480233 AAGGGGGAAAAGAGGGAAGTAGG + Intergenic
1069252932 10:66294320-66294342 CTGTGGGTAGAGAGAGAAGAAGG + Intronic
1070058781 10:72960882-72960904 TAGTGGGCATAGGGGGAAGTGGG - Intergenic
1070307938 10:75250960-75250982 CAGTGGGCAGAGAGGAGCCTGGG + Intergenic
1070597784 10:77844858-77844880 CACTGGGCAGAGAGGGGGGCAGG + Intronic
1070817629 10:79335389-79335411 GAGTGGGCAGAGAGGAAAATGGG + Intergenic
1070976331 10:80608834-80608856 CAGTGAACAGAGAGAGAAGCTGG - Intronic
1071017484 10:81015070-81015092 CAGAGGGGAGGGAGGGAAGGAGG + Intergenic
1071463621 10:85920753-85920775 CTGTGGGCGGGGAGGGAAGGGGG + Intronic
1072087525 10:92095138-92095160 GAGTGGGCAGAAAAGGCAGTAGG - Intronic
1072128117 10:92465660-92465682 CAGTTGGGTGAGAGGAAAGTGGG - Exonic
1072249245 10:93568516-93568538 AAGTGGTCAGAGAGGGGAGTAGG + Intronic
1072314889 10:94192334-94192356 GAGGGGGAAGAGAGGGAGGTGGG - Intronic
1073426571 10:103458808-103458830 CAGTGGGCAGGGTGGGCAGCAGG - Exonic
1073466794 10:103698951-103698973 GACTGGGCAGTGAGGGTAGTGGG + Intronic
1073473823 10:103740057-103740079 TAGTGGGCAGAGGAGGAAGGAGG + Intronic
1073674387 10:105628827-105628849 CAATATGCAGAGAGGGAAGCAGG - Intergenic
1074544702 10:114393579-114393601 CTGGGGACAGGGAGGGAAGTTGG + Intronic
1075360354 10:121826760-121826782 GAGTGGGGAGAGAGGGAAGGTGG - Intronic
1075469612 10:122678217-122678239 CACAGGGAGGAGAGGGAAGTAGG + Intergenic
1075979561 10:126724884-126724906 CACTGGGGTGAGAGGGGAGTGGG - Intergenic
1076162301 10:128254620-128254642 CAGCAGGCAGAGAGGGAGGTTGG + Intergenic
1076169683 10:128308938-128308960 CAGTGTGCAGAGGTGGTAGTTGG + Intergenic
1076182280 10:128419511-128419533 CAGTGGCCAAAGAGTGCAGTGGG - Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077198490 11:1293401-1293423 GTGTGGGCAGAGAGGGGAGGAGG + Intronic
1077362567 11:2147215-2147237 AAGTGGGTAGAGAGGGAAAAAGG - Intronic
1077377408 11:2211496-2211518 CAGTGGGCAGAGAGAGCACACGG + Intergenic
1077458433 11:2695013-2695035 CAGTGGTCAGAGAGGTAAGCAGG + Intronic
1077906870 11:6541098-6541120 CTGTGTGGAGAGAGGGAGGTGGG + Intronic
1078450334 11:11436214-11436236 CATAGAGCAGAGAGGGAAGGTGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078605981 11:12776007-12776029 CAGTGGGCAGGGAGGGGTGCAGG + Intronic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1079327344 11:19505568-19505590 GAGTGGGGAGAGAGAGAAGAAGG + Intronic
1079642004 11:22817129-22817151 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
1080049292 11:27842571-27842593 CATTGGGCAGAGGGGAAAATTGG - Intergenic
1080368964 11:31611856-31611878 AAGTGGGCAGAGAGGGCAGTGGG + Intronic
1080447579 11:32351784-32351806 GAGTAGGGAGAGAGGGGAGTAGG - Intergenic
1080620186 11:33980803-33980825 CAGTTGTCACAGAAGGAAGTTGG - Intergenic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1082026694 11:47578005-47578027 CAGCTGGCAGAGAGAGAAGTTGG - Exonic
1083332151 11:61903919-61903941 CAGTGGGGGGACAGGGAATTGGG - Intronic
1083550951 11:63589922-63589944 GGGTGGGGAGAGAGGCAAGTTGG - Intronic
1083668200 11:64286415-64286437 CAGGGTGCAGAGAGGGAGATGGG - Intronic
1083702805 11:64490837-64490859 CAGTGGGCAGCGTGGGGACTGGG - Intergenic
1083735186 11:64676122-64676144 CAGCGGGCAGAGAGGGCAGGGGG + Intronic
1083994854 11:66266850-66266872 CTGTGGGCAGAGGGGGCAGGTGG - Intronic
1084534149 11:69746926-69746948 CAGCAAGCAGAGAGGGAAGGTGG - Intergenic
1084542678 11:69797322-69797344 CAGTGAGCAGAGAAGGACGCTGG + Intergenic
1084859518 11:72009186-72009208 CTGTGGGCAGAGAGGGTGGGTGG + Intronic
1084982720 11:72840017-72840039 GAGTGGGAAGAGAGAGCAGTGGG - Intronic
1085004619 11:73074929-73074951 CAGTGGGGAGGGAGGGAGGCAGG + Intronic
1085122719 11:73977587-73977609 CAGTGGGTAGAGTGGGGACTTGG - Intronic
1085314672 11:75537287-75537309 CAGTGGGGCTAGAGGGCAGTGGG + Intergenic
1085854226 11:80157962-80157984 CATTGAGCAGAGGGAGAAGTTGG - Intergenic
1085930520 11:81077219-81077241 CAGTGGGAAGACAGAGAAGAAGG - Intergenic
1086314831 11:85580366-85580388 GAGTGGGAAGAAAGAGAAGTTGG - Intronic
1086748334 11:90457719-90457741 GACTGGGGAGAGAGGGAAGTGGG + Intergenic
1087353700 11:97066506-97066528 GAGTGGGGAGAGAGGGAGGATGG + Intergenic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087645154 11:100800331-100800353 CACTGGGAACAGAGGGGAGTTGG + Intronic
1088569438 11:111207332-111207354 CAGTGAGTAGAGAGAGAAGATGG - Intergenic
1088695360 11:112361709-112361731 CAGTGTGCAGAGAGTGTGGTGGG + Intergenic
1089116058 11:116096103-116096125 GAATGGGCAGAGGGAGAAGTTGG + Intergenic
1089577824 11:119459371-119459393 CAGTAGGCAGAGAGAGGGGTTGG + Intergenic
1089689604 11:120179107-120179129 CAAGGGCCAGAGAGGGAAGCTGG + Intronic
1090078675 11:123595753-123595775 CAGTGGGCAGACAGCAAAGTGGG - Intronic
1090184411 11:124727071-124727093 GAGAGGGCATACAGGGAAGTGGG + Intergenic
1090248631 11:125235877-125235899 CAGTGGGCAGACTGAGAAGTAGG - Intronic
1091001575 11:131914110-131914132 CTGTGTACAGAGAGGCAAGTAGG + Intronic
1091265772 11:134270040-134270062 CAGGGGCCAGAGAATGAAGTGGG + Intergenic
1091357314 11:134947267-134947289 CAGTGGACAGAGTGGGAAGGTGG - Intergenic
1091440008 12:505392-505414 CAGTGGGAACAGAGGAAAGGGGG - Intronic
1091587016 12:1822282-1822304 CAGTGGGCAGTGTAGGAAGGAGG + Intronic
1091746320 12:2995199-2995221 CGGTGAGCAGAGATGGGAGTGGG + Intronic
1092845936 12:12585331-12585353 CAGTAGGCAGTCAGGGAAATGGG + Intergenic
1093232627 12:16566243-16566265 AAGGGAGCAGAGAGGGAAGGAGG + Intronic
1093718882 12:22414787-22414809 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1093739031 12:22659374-22659396 CAAGGGGCAGAGGTGGAAGTAGG + Intronic
1094701139 12:32871977-32871999 GAGTGGGGAGAGAGAGAAGGAGG - Intronic
1095685551 12:45029516-45029538 GAGTGGGCAGGGAAAGAAGTGGG + Intronic
1096534205 12:52260534-52260556 GCTTGGGCACAGAGGGAAGTAGG - Intronic
1096635977 12:52959889-52959911 AAGTCAGGAGAGAGGGAAGTGGG - Intergenic
1096747691 12:53739163-53739185 AAGTGAGCAGAGTGGGAGGTGGG + Intergenic
1096838686 12:54368223-54368245 AAGTGAGCAGAGATGAAAGTCGG + Intergenic
1097167529 12:57093696-57093718 TAGTCGTCAGAGAGGGCAGTAGG + Intronic
1097386986 12:58962014-58962036 GAGTGGGGAGAGAGGGCAGCAGG - Intergenic
1098226678 12:68332037-68332059 GAGTGAGCGGAGAGGGAACTAGG + Intronic
1098316283 12:69196848-69196870 CAGAGGGCAGTGAGAGACGTAGG - Intergenic
1099626764 12:85085582-85085604 CAGAGGGGAGAGAGTGAAGCAGG - Intronic
1101012731 12:100467670-100467692 CAGTGGGGACAGAGGCCAGTTGG + Intergenic
1101649143 12:106659040-106659062 CAGGGGTCAGGGAAGGAAGTGGG - Intronic
1101898338 12:108772170-108772192 AAGTGGGCAGGGAGAGAAGAGGG + Intergenic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103721008 12:122975412-122975434 CAGTGGGCAGAGAGGGGTAGTGG + Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1103912606 12:124360635-124360657 GGGTGGACAGTGAGGGAAGTGGG - Intronic
1103932098 12:124456320-124456342 CAGTGGGCACAGATGGCTGTGGG + Intronic
1103999146 12:124849326-124849348 CCGTGGGCAGAGAGGGGATGAGG - Intronic
1104026739 12:125032995-125033017 CAGCGGGCAGAAGGGGCAGTGGG - Intergenic
1104239601 12:126975078-126975100 CAGGGTGCAGAGCAGGAAGTAGG + Intergenic
1104388579 12:128372694-128372716 ATGTGGGCTGAGAGAGAAGTTGG + Intronic
1104591104 12:130085295-130085317 CAGGGAGCAGTGAGGGAAGCAGG - Intergenic
1104832505 12:131763298-131763320 CAGGTGACTGAGAGGGAAGTGGG - Intronic
1104903722 12:132202723-132202745 CAGTGGCCAGGGAAGGAAGGGGG + Intronic
1105370128 13:19794919-19794941 CAGTGGGGAGGTAGGCAAGTGGG + Intergenic
1105519321 13:21117382-21117404 CAGAGGGTAGAGAGGCAAATGGG + Intergenic
1105966439 13:25388817-25388839 CAATGGGCAGGAGGGGAAGTTGG + Intronic
1106635980 13:31528837-31528859 GAATGGGGAGAGAGGGAAGAGGG - Intergenic
1106768940 13:32943523-32943545 TTGAGGGCAGAGATGGAAGTGGG - Intergenic
1106907048 13:34420172-34420194 CAGTGGTCAGTGAGGGTTGTTGG - Intergenic
1107080731 13:36372173-36372195 GTGTGGGCAGAAAGGGAGGTAGG - Intergenic
1107361426 13:39621758-39621780 CTGTGGTCTGAGAGGGTAGTTGG - Intergenic
1107755234 13:43614606-43614628 CAGTGAGCAGGGAGAGAAGGAGG - Intronic
1108068979 13:46607949-46607971 CTGAGGGCAGGGAGGGATGTGGG + Intronic
1109172057 13:59108554-59108576 GAGTGAGCAGAGAGTGAAGGGGG - Intergenic
1109237059 13:59835716-59835738 CAGTTGTAAGAGTGGGAAGTGGG - Intronic
1109242936 13:59913386-59913408 CTGTGGGCTGTGAGGGAAGCTGG - Intronic
1110121633 13:71888806-71888828 CAGTTGGCAGAGAGGGAATGTGG + Intergenic
1110436849 13:75485185-75485207 CAGTGGGAAGAAAAGGCAGTTGG - Intergenic
1110642669 13:77843523-77843545 CACTGGGCAGGGAGGTTAGTAGG - Intergenic
1111585878 13:90284305-90284327 GAGTGGGCAGAGAAGGAAAAAGG + Intergenic
1111918941 13:94390535-94390557 CAGGAGGAAGAGAGGGAAGGGGG + Intronic
1112249192 13:97763440-97763462 GAGTGGGGAGATAGGGAATTGGG + Intergenic
1112486605 13:99825886-99825908 TGGTGGGCAGAGAGGGGACTGGG - Intronic
1112923142 13:104640516-104640538 CAATGGGCAAAGAGGGAATGAGG - Intergenic
1113323777 13:109264366-109264388 CAGTTGCCAGTGAGGGGAGTTGG - Intergenic
1113504514 13:110806013-110806035 TTGTGGGCAGAGAGGGAAAGTGG + Intergenic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1113698791 13:112367126-112367148 ATGAGGGCAGAGAGGGAAGCTGG + Intergenic
1114473138 14:22977494-22977516 CACTGGACAGAGTTGGAAGTAGG - Intronic
1115243562 14:31272680-31272702 CAGGTGGCAAAGAGGGAAGGAGG - Intergenic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115397636 14:32926578-32926600 CAGTGGGGTAAGGGGGAAGTGGG + Intergenic
1116028004 14:39537543-39537565 CAGTGAGGAGATATGGAAGTGGG - Intergenic
1116389341 14:44374488-44374510 CAGGAGGCAGAGGGTGAAGTGGG - Intergenic
1116426814 14:44800440-44800462 GAGTGGGGAGAGAGGGAAGGGGG + Intergenic
1117325427 14:54664575-54664597 CAGGAGGAAGAGAAGGAAGTGGG - Intronic
1117497822 14:56323300-56323322 CAGCGAGCAGAGAGGGATGGCGG - Intergenic
1117939242 14:60943571-60943593 CAGTGGGCAGTGAGGGAGTGGGG + Intronic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1118347078 14:64948284-64948306 CCGTGGGCAGACAGGGGAGCCGG - Exonic
1118888970 14:69891544-69891566 CAGGGGGTAGGGAGGGAAGAGGG - Intronic
1119386375 14:74260228-74260250 CAGAGGGCAGGTGGGGAAGTTGG - Intronic
1119425300 14:74531155-74531177 CAGGCGGCAGGGAGGGAAGGAGG + Intronic
1119509003 14:75196604-75196626 CAGTGGTGAGAGTGGGAGGTGGG - Intergenic
1120647236 14:87088626-87088648 AAGTGGGAAGTGGGGGAAGTTGG + Intergenic
1120792451 14:88597652-88597674 CAGGAGGCAGAGAATGAAGTTGG - Intronic
1120953860 14:90064340-90064362 CAGTGGGCACAGAGGCAGGAAGG + Intronic
1121085784 14:91145192-91145214 AATGGGGCAGAGAGGGAGGTTGG - Intronic
1121832681 14:97065744-97065766 CAGTAGGCAGAGAAGGAAAAGGG + Intergenic
1122007432 14:98717004-98717026 CACTTGGCAGAGAGGGAGGCGGG + Intronic
1123047249 14:105524992-105525014 CAGTGGCCAGTGTGGGACGTGGG + Intergenic
1123467330 15:20526774-20526796 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1123650784 15:22474268-22474290 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123741192 15:23283110-23283132 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1123745805 15:23319448-23319470 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1123800472 15:23814564-23814586 CCGTGGGCAGACAGGGTAGTGGG + Intergenic
1123967178 15:25470740-25470762 TAGTGGGCAGAACGGGAAGTCGG + Intergenic
1124278077 15:28342765-28342787 AACTGGGCTGAGAGGGAAGGGGG + Intergenic
1124304626 15:28568843-28568865 AACTGGGCTGAGAGGGAAGGGGG - Intergenic
1124398078 15:29322771-29322793 AAGTGGGCAGGAAGGGAAGGAGG - Intronic
1124484195 15:30101180-30101202 GAGCGGGCAAAGAGGGAAGGAGG + Intergenic
1124490586 15:30152532-30152554 GAGGGGGCAAAGAGGGAAGGAGG + Intergenic
1124519387 15:30396044-30396066 GAGCGGGCAAAGAGGGAAGGAGG - Intergenic
1124539268 15:30570177-30570199 GAGCGGGCAAAGAGGGAAGGAGG + Intergenic
1124702591 15:31929681-31929703 CAGTGGGGAGAGTGTGGAGTGGG - Intergenic
1124752947 15:32385797-32385819 GAGGGGGCAAAGAGGGAAGGAGG - Intergenic
1124759382 15:32437395-32437417 GAGCGGGCAAAGAGGGAAGGAGG - Intergenic
1124949498 15:34303755-34303777 CAGAGGGCAGAGAGGGTAAGAGG - Intronic
1124974690 15:34521497-34521519 GAGGGGGCAAAGAGGGAAGGAGG - Intergenic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1126464615 15:48950609-48950631 CAGTGGGGATGGAGGGAAATGGG + Intronic
1127230385 15:56985958-56985980 GAGTGGACAGAAAGGGAAGAGGG + Intronic
1127489396 15:59447998-59448020 CTGTGGGGAGAAAGGGAAGAGGG + Intronic
1127776890 15:62270645-62270667 CACAGGGCAGGGAGGGAGGTGGG + Intergenic
1127817653 15:62625836-62625858 GAGTGGGCAGAGTGGGCAGATGG + Intronic
1128114085 15:65094586-65094608 AAGCGGGCAGAGAGGGAGGGAGG + Intronic
1128250806 15:66163146-66163168 CAGAGGGCAGAGGGGGAATCTGG + Intronic
1128480289 15:68031551-68031573 CTGGAGGCAGAGAGGGAAGTTGG - Intergenic
1128524304 15:68402085-68402107 CAGGGGCCAGAGTGGGAAGAGGG + Intronic
1128603825 15:69019284-69019306 AAGGGGGCAGGGAGGGATGTAGG + Intronic
1129177876 15:73853002-73853024 GATTGGGCAGAGGGAGAAGTTGG - Intergenic
1129210136 15:74063662-74063684 GAGTGGGCAAAGAGGGAAGGAGG - Intergenic
1129403885 15:75301740-75301762 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1129826915 15:78640532-78640554 CACTGGGCCGAGAAGGAAGGGGG - Intronic
1129842075 15:78750106-78750128 GAGTGGGCAAAGAGGGAAGGAGG + Intergenic
1130172657 15:81531692-81531714 CAGTGGGCACTGAGGGAGGAGGG - Intergenic
1130234997 15:82125334-82125356 CAGAGGGGAGAGAGGGAGTTGGG + Intergenic
1130275058 15:82472182-82472204 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130282961 15:82533291-82533313 GAGTGGGCAAAGAGGCAAGGAGG + Intergenic
1130467407 15:84199551-84199573 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130496853 15:84473984-84474006 GAGTGGGCAAACAGGGAAGAAGG + Intergenic
1130554575 15:84913866-84913888 AAGTAGGCAGAGAGCAAAGTGGG - Intronic
1130589702 15:85204149-85204171 GAGTGGGCAAACAGGGAAGAAGG - Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131051688 15:89352434-89352456 CAGTGGGTAGAAATGGGAGTCGG + Intergenic
1131133648 15:89916195-89916217 GAGTTGGCACAGAGGGAGGTAGG - Intergenic
1131177883 15:90221247-90221269 TGGTGGGCAGAGAAGGAAGCTGG - Intronic
1131227604 15:90638466-90638488 CTGTGGGCAGAAAGGAAAGTTGG - Exonic
1131301387 15:91202714-91202736 GACTGGCCAGAGAGAGAAGTGGG + Intronic
1131687992 15:94792042-94792064 AGCTGGGCAGAGAGGGAAGTTGG + Intergenic
1131770058 15:95727506-95727528 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1132210510 15:100018535-100018557 CAGGAGGAAGAGAGAGAAGTGGG - Intronic
1132555837 16:572286-572308 CAGTGGTCAGAGAGGGCAGGCGG - Intronic
1132629257 16:908914-908936 CAGAGGGCAGAGAGGAAAGCTGG + Intronic
1132743279 16:1426511-1426533 CAGTGGGCTGAGTGGGACGGGGG - Intergenic
1132753587 16:1470912-1470934 CAGGGGGCAGTGAGGGGAGGTGG - Intronic
1133046053 16:3088978-3089000 AAGTGGAAGGAGAGGGAAGTGGG + Exonic
1133287624 16:4697931-4697953 CACTGGGCAGAGGGGAAGGTGGG - Intronic
1133524056 16:6587176-6587198 CAGTGCGGAGAGAGGGGAGCTGG - Intronic
1133625117 16:7563883-7563905 CAGTGGGCAGGGTTGGAGGTTGG - Intronic
1133964810 16:10523000-10523022 CTGTGGGTAGACAGGGAACTGGG + Intergenic
1134030771 16:10990605-10990627 CAGTGGGCAGGGATGGGAGCAGG + Intronic
1134131293 16:11651983-11652005 CAGGGGGCAGATGAGGAAGTGGG + Intergenic
1134692038 16:16197493-16197515 CAGAGGGAAGAGAGGGAGGACGG + Intronic
1135181842 16:20281592-20281614 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1135875550 16:26196666-26196688 CAGTGGGCAGGGTGGGTAGAGGG + Intergenic
1135940931 16:26821158-26821180 CATTGGTCTGAGAGGGAGGTGGG + Intergenic
1136158238 16:28400213-28400235 CAGTGGGCAAACAGGGATCTGGG - Intronic
1136204849 16:28715070-28715092 CAGTGGGCAAACAGGGATCTGGG + Intronic
1136542844 16:30937917-30937939 CAGTGGGCAGAGAGAGGTTTTGG + Intronic
1137263425 16:46849583-46849605 CAAGGGGCAGAGAGAGAAATGGG - Intergenic
1137407153 16:48198107-48198129 CCGTGGGTAGTGAGGGCAGTGGG + Intronic
1137491965 16:48940604-48940626 CAGCAGGCAGAGAGGGCAGCTGG + Intergenic
1137679967 16:50332981-50333003 AAGGGGGCAGGGAGGGAAGGGGG + Intronic
1137746494 16:50824281-50824303 GTGTGGGGAGAGAGGGAAGAGGG + Intergenic
1137991590 16:53162213-53162235 CAGTGGGAAGAGAGGCCAGAGGG + Intronic
1138093697 16:54195938-54195960 AAGTGAGAAGAGAGGGAAGGAGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138590259 16:57995859-57995881 CAGTGGGCCCAGGGGGAAGGGGG - Exonic
1139602953 16:67997923-67997945 CAGTGGGCAGAGTGGAAACAAGG - Intronic
1139615063 16:68084054-68084076 CAGTGGGAAGAGAGGGTAAAGGG - Intergenic
1139662436 16:68430205-68430227 GAGGGGGCATAGAGGGAAGAGGG - Intronic
1139691672 16:68645607-68645629 CCGAGGGCAGAGAGTGAAGGAGG - Intronic
1140828599 16:78730300-78730322 AAGGAGGCAGAGAGGGAAGGAGG - Intronic
1140985684 16:80156287-80156309 CACTGGGCAAAGAAGGAAGAAGG + Intergenic
1141032819 16:80604344-80604366 CACAGGGCAGAGCTGGAAGTTGG + Exonic
1141137220 16:81474289-81474311 CAGTAGGGAGAGAGGGAGGGAGG - Intronic
1141841090 16:86574582-86574604 AAGTGGGCGGGGAGGGAAGGAGG + Intergenic
1141932634 16:87216242-87216264 CTGTGAGCTGAGAGGCAAGTCGG - Intronic
1142067518 16:88071352-88071374 CAGTGGATTGAGTGGGAAGTGGG + Intronic
1142504162 17:352343-352365 CAGTGGACAGAGATGGATTTGGG - Intronic
1142548211 17:720511-720533 CAGTAGGCTGTGAGGGAGGTGGG + Intronic
1142753976 17:2004670-2004692 CCCTGGGCAGAGAGGGCAGAGGG + Intronic
1143026960 17:3946725-3946747 CAGTGGGCAGATGTGGAAGCAGG + Intronic
1143364380 17:6396310-6396332 GACTGGGCAGAGAAGGAAGAAGG + Intronic
1143495670 17:7311327-7311349 CTGGGGGCAGATAGGGAAGGAGG - Intronic
1143792514 17:9308768-9308790 CCTTGGGCAGAAAGGGAAGCAGG + Intronic
1144105390 17:11980157-11980179 AATTGGGCAGAGGGGGAAGTGGG + Intronic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144352010 17:14405605-14405627 CAGTGGGAAGAGAGGAAGGCTGG + Intergenic
1144670935 17:17132220-17132242 CACTGGCCAGGGAGGGAAGGAGG - Intronic
1144702044 17:17346476-17346498 CAGGGCACGGAGAGGGAAGTCGG + Intronic
1145006757 17:19342753-19342775 AGGGGGGCAGAGAGGGGAGTGGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1145088637 17:19967196-19967218 CAGTGTACAGAGATTGAAGTGGG - Intronic
1145115210 17:20203908-20203930 CAGATGGCAGAGAAGGAAGAAGG - Intronic
1145264597 17:21373761-21373783 CATTTTACAGAGAGGGAAGTGGG + Intergenic
1145905532 17:28514302-28514324 GAATGGGCAGGGAGGGGAGTGGG - Intronic
1146299097 17:31674263-31674285 CAGTAGGCAAGGAGGGAAGAAGG + Intergenic
1146322324 17:31856771-31856793 TAGATGGCAGAGACGGAAGTTGG - Intronic
1146552963 17:33797974-33797996 CAGTGTGCAAAGGAGGAAGTGGG + Intronic
1147359409 17:39921725-39921747 ATGTGGGCAGGGAGGGAAGCAGG - Intronic
1147497099 17:40927055-40927077 CAGTGAGCAAAGAGGTAAGGAGG - Intronic
1147989540 17:44324508-44324530 CAGCCGGGAGAGCGGGAAGTAGG + Intronic
1148048291 17:44757409-44757431 TGGAGGGCAGAGATGGAAGTAGG + Intergenic
1148079102 17:44957708-44957730 CAGCTGGCAGTGGGGGAAGTAGG + Intergenic
1148239052 17:45988082-45988104 CCGTGTGCAGCGAGGGAAGGAGG + Intronic
1148612344 17:48972654-48972676 GAGAAGCCAGAGAGGGAAGTCGG - Intergenic
1149180276 17:53928079-53928101 TAGTGGGTTGAGGGGGAAGTGGG - Intergenic
1149535702 17:57431817-57431839 CTGGGGGCAGAGAGTGAAGTGGG - Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1149588392 17:57809180-57809202 GAGTGGGGAGAGAGGGAGGCAGG + Intergenic
1149637218 17:58180747-58180769 CAGGGTGCAGGGAGGGAAGGGGG - Intergenic
1150640855 17:66948506-66948528 CAGTGCCGAGAGAGGGCAGTTGG - Intergenic
1151341033 17:73471133-73471155 TGGGGGGCAGAGAGTGAAGTGGG - Intronic
1151512709 17:74571059-74571081 CAGTGGGGAGGGAAGAAAGTGGG - Intergenic
1151630738 17:75309261-75309283 CAGTGGGGAGAGGGGGACGAAGG + Intergenic
1151698608 17:75730885-75730907 CAGTGAGGAGACAGGGAAATAGG - Exonic
1151758975 17:76090069-76090091 AAGCAGGCAGAGAGGGAAGGTGG - Intronic
1152013653 17:77735771-77735793 CAGTGGGCGGGGAGGGAGGGAGG - Intergenic
1152542248 17:80982227-80982249 TAGTGGGGAGGGAGGGAAGGTGG - Intergenic
1152747672 17:82048836-82048858 CCGTGGGCGGAGAGAGAAGCGGG + Intronic
1153599114 18:6761636-6761658 CAGTGGTCAGTGAGGGAATTGGG + Intronic
1153802037 18:8679844-8679866 AAGGGGGCAGGGAGTGAAGTAGG + Intergenic
1153934481 18:9908955-9908977 AAGTGGCCAGAGAGGTAAGTAGG - Intergenic
1155108364 18:22689254-22689276 CTGGAGGCAGAGAGGGAAGCTGG + Intergenic
1156269378 18:35517025-35517047 CAGTGGGCAGACAGTGACGGTGG - Intergenic
1156494335 18:37516181-37516203 CAGGGGGCAGGAAGGGATGTTGG - Intronic
1156673226 18:39496184-39496206 AAGTGGGTAGAGATGGAAGAAGG - Intergenic
1156732506 18:40211588-40211610 CAGAAGGCATAGAGGAAAGTGGG + Intergenic
1157328079 18:46683518-46683540 CTGAGGGCAGAGAGGGAAGAAGG + Intronic
1157395389 18:47336772-47336794 GTGTGGACAGGGAGGGAAGTGGG + Intergenic
1157750055 18:50170191-50170213 CAGTGGGCAGTGAGGAAAGGAGG + Intronic
1157792174 18:50542404-50542426 CAGTCAGCAGAGAGGGAGTTGGG - Intergenic
1158722171 18:59935281-59935303 CAGGGGGTTGAGAGGGTAGTGGG + Intergenic
1160448782 18:78947616-78947638 CGGTGGGCAGAGAAGGGAGCTGG + Intergenic
1160613245 18:80105465-80105487 GAGTGAGCAGAGCGGGAAGTGGG + Intergenic
1161258896 19:3324720-3324742 TAGTGGGAAGAGAGGGAAGAAGG - Intergenic
1161480553 19:4508210-4508232 CTGTGTGCAGAGGGGGATGTGGG - Intronic
1161568019 19:5014030-5014052 CTGTGGGAAGATATGGAAGTCGG + Intronic
1161762275 19:6182947-6182969 CAGAGGGCTGGGAGGGTAGTTGG + Intronic
1162475479 19:10896861-10896883 TAGTGAGCAGATAGGGAAGTGGG + Intronic
1162847765 19:13406669-13406691 CACTGGGCAGAGAGGGTGGGTGG + Intronic
1162909952 19:13843145-13843167 CAGGGTCCAGAGGGGGAAGTTGG - Intergenic
1162967610 19:14163496-14163518 GAGGGGGGAGAGAGGCAAGTTGG + Intronic
1163157208 19:15445996-15446018 AAGCGGGCAGAGAGGGCAGTGGG + Intronic
1163207420 19:15813828-15813850 AAGTGGAGAGAGAGGGAGGTGGG + Intergenic
1163453309 19:17391709-17391731 GAGTGGGCAGGGATAGAAGTGGG - Intergenic
1163566472 19:18054869-18054891 CAGAGGGCAGAGTTGGAAGAAGG + Intergenic
1164678760 19:30120196-30120218 GAGTGGGCTGAGAGGTAAGGAGG + Intergenic
1164813686 19:31177842-31177864 CACTGCGCAGAGAGGGGAGGCGG + Intergenic
1165126287 19:33600244-33600266 CATGGGGCAGAGAGGGGAATGGG + Intergenic
1165142970 19:33713447-33713469 CTGTAGGAAAAGAGGGAAGTGGG - Intronic
1165150921 19:33759630-33759652 CAGTTGGAGGAGAGGGAATTAGG - Intronic
1165405803 19:35630396-35630418 GAGTGAGCAAAGAGGAAAGTGGG + Intronic
1165767313 19:38359602-38359624 GGGTGGGCAGAGAGGGAACGGGG - Intronic
1165767494 19:38360413-38360435 CACTGGGCAGAGGGTGAGGTGGG + Intronic
1166518606 19:43464678-43464700 CAGTGGGCATACAGGGCTGTCGG - Intronic
1166564593 19:43755727-43755749 CAGTGGGCAGAGTGGGTGGATGG + Intergenic
1166587570 19:43963899-43963921 CACTCGGAAGAGTGGGAAGTAGG + Intronic
1167284745 19:48592699-48592721 CTGTGGGCAGAGGGACAAGTGGG - Intronic
1167353146 19:48988196-48988218 GAGTGGCCAGACAGGGCAGTGGG - Intronic
1167618383 19:50548508-50548530 CAGCGGGCAGAGGGGGACCTTGG - Intronic
1168167925 19:54565999-54566021 CAGTGGACAGGGAGAAAAGTAGG + Intergenic
1168174248 19:54611927-54611949 GAGTGGGGAGAGAGGGAGGAGGG + Intronic
1168189784 19:54729670-54729692 CACAGGGCCCAGAGGGAAGTTGG - Exonic
1168297950 19:55386830-55386852 AAGTCGGCCGAGAGGGAAGCCGG - Intronic
1168472685 19:56652243-56652265 CAGCGGGGAGTGAGGGAAGCTGG + Intronic
925187998 2:1862718-1862740 AAGAGGGCAGAGAGAGAGGTTGG + Intronic
925291765 2:2752593-2752615 CTGTGGGCAGGGAGGGAGGGAGG + Intergenic
925505363 2:4556375-4556397 CAGTGGCCAGAGACGGGAGAGGG + Intergenic
927112883 2:19876905-19876927 CAGTGGGGAGATAGGGGATTTGG - Intergenic
927192286 2:20524930-20524952 AAGCGGGCAGAGGCGGAAGTGGG + Intergenic
927352795 2:22137554-22137576 CAATAGCAAGAGAGGGAAGTAGG + Intergenic
927667952 2:25045141-25045163 GAGTTGGCAGAGAGGAAAGGAGG - Intronic
927712096 2:25332382-25332404 CAGGGCTCAGAGAAGGAAGTCGG - Intronic
927712224 2:25332970-25332992 CAGTGGGCAGGGAGGGAAAGAGG + Intronic
928035046 2:27815138-27815160 CAATGGGCATTGAGGGCAGTGGG + Intronic
928494403 2:31817449-31817471 AAGTGGGCAAGGAGGGAGGTGGG - Intergenic
929456990 2:42073030-42073052 GAGGGTGCAGAAAGGGAAGTTGG + Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929581718 2:43085618-43085640 CAGTGGACAGAGATGGGAGCAGG - Intergenic
929593265 2:43160438-43160460 GGTTGGGCAGAGAGAGAAGTGGG - Intergenic
929883365 2:45856684-45856706 CAGGGGGGATGGAGGGAAGTTGG - Intronic
930195499 2:48505926-48505948 CAGTGGGCAGCCAGGAAAGCAGG + Intronic
930206696 2:48594090-48594112 AAATGGGCAGAGAGAGAAGCTGG - Intronic
930547978 2:52793875-52793897 CAGTGGGGAGAGATGGAATGAGG + Intergenic
931869030 2:66439848-66439870 CAGTGCTAAGAGAGGGAAGAGGG - Exonic
932048644 2:68376919-68376941 CAGAGGCCAGGAAGGGAAGTGGG - Intronic
932231567 2:70087827-70087849 CATTGGGAAGAAAGGGGAGTCGG + Exonic
932421602 2:71604523-71604545 CAGGGGGCAGTGAGGGAAGATGG + Intronic
932425494 2:71631833-71631855 CAGTGTGCAGCGAGGGAGGAGGG - Intronic
932446079 2:71782438-71782460 CAGAGAGCAGAAATGGAAGTAGG + Intergenic
932524288 2:72446620-72446642 GAGTGGGGAGAGTGGGAAGAAGG + Intronic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933890862 2:86768527-86768549 GATTGGGCAGAGAGGAAAGTTGG + Intronic
934039030 2:88112365-88112387 CAGTGGTCTGAGAGGGAAGGAGG - Exonic
936068423 2:109349474-109349496 CACTGGGCAGAGAAGCAAGTTGG - Intronic
936241349 2:110790988-110791010 AAGGAGGCAGACAGGGAAGTGGG - Intronic
936288540 2:111200220-111200242 TAGGGGGCAGGGAGGGGAGTGGG - Intergenic
936449993 2:112626768-112626790 CAGTGGGCAGTGAGGGGGCTAGG - Intergenic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937080726 2:119137773-119137795 CAGTGGCCAGAGAGGGCAGGTGG + Intergenic
937248369 2:120508686-120508708 CAGTTGGCAGAGACAGAACTGGG - Intergenic
937303486 2:120857348-120857370 GAGTGGGCAGATAGGTAGGTGGG - Intronic
937322671 2:120970364-120970386 CAGAGAGCAGACAAGGAAGTGGG - Intronic
937324418 2:120981785-120981807 AGGTGGGGAGAGAGGGAAGAAGG - Intronic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
937639766 2:124198559-124198581 GAGTGGGGAGAGAGGGAGGAGGG - Intronic
937862213 2:126720085-126720107 CTGTGGGCCTTGAGGGAAGTGGG + Intergenic
937985949 2:127638181-127638203 CAGTGGGCAGAGGAGGAGGTGGG - Intergenic
938220310 2:129560657-129560679 CAGGGGACAGAGAGAGAAGGAGG - Intergenic
938320035 2:130356374-130356396 CGGGGGGCAGAGAGTGAAGACGG - Intronic
938730505 2:134143386-134143408 AAGTGGGCAGGGAGTGAAGTGGG + Intronic
938730574 2:134143899-134143921 CAGTGAGAAGATAGGGATGTGGG + Intronic
938904539 2:135825816-135825838 CTGTGGGCTGCGAGGGAAGAGGG - Intronic
938969269 2:136417255-136417277 CAGTGGGAAGTTAGGGCAGTAGG + Intergenic
939120943 2:138115766-138115788 TAGTGGGCAAAGATAGAAGTAGG - Intergenic
940476807 2:154172447-154172469 CAGAGGCCAGAAAGGGTAGTGGG - Intronic
940652843 2:156454681-156454703 CAGAGGGCAGAGTGGGAGGGAGG + Intronic
942393762 2:175524511-175524533 CAGTGGGGAGACAAGGCAGTTGG - Intergenic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942810692 2:179996633-179996655 CAGAGGCCAGAAAGGGGAGTGGG + Intronic
942828553 2:180210517-180210539 TAGTGGGAAGAGAGAAAAGTAGG + Intergenic
943172397 2:184419311-184419333 CAGTGGGGAGACTAGGAAGTTGG + Intergenic
943182688 2:184563005-184563027 AATTGGGCAAAGAGAGAAGTTGG + Intergenic
943267034 2:185745150-185745172 CACTGGGCACAGAATGAAGTGGG - Intronic
943657968 2:190529323-190529345 CAGTGGGCTGGGAGGGAAGGTGG - Intronic
943977925 2:194507838-194507860 CAGAGGAAAGAGTGGGAAGTGGG + Intergenic
944401544 2:199332365-199332387 CAGTGGAAAAAGAAGGAAGTTGG + Intronic
944661017 2:201921580-201921602 CACTGAACTGAGAGGGAAGTGGG - Intergenic
945239401 2:207662377-207662399 CAGAGGGCAGAAAGGGAAAAGGG - Intergenic
946372973 2:219291629-219291651 CCCGGGGCAGAGAGGGAAGATGG + Intronic
946477499 2:220022397-220022419 AAGTGGGCAGAGTGGGTGGTAGG + Intergenic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946666958 2:222060471-222060493 TCATGGGCAGAGAGGGAAGGAGG + Intergenic
946938241 2:224744034-224744056 CAGTGGTCAAACAGGGGAGTTGG + Intergenic
946953705 2:224905782-224905804 GAGTGGGCAGAGAGGAAAGCGGG - Intronic
948281457 2:236750489-236750511 CAGTGAGCACAGAGAGATGTAGG + Intergenic
948341191 2:237253646-237253668 CAGGGGGCAGAGGGGCATGTAGG - Intergenic
948425717 2:237885677-237885699 CGGTGGGCAGGGAGGTCAGTAGG - Intronic
948516631 2:238508090-238508112 CAGCCAGCAGAGAGGGAAGCTGG - Intergenic
948668974 2:239554294-239554316 CACTGGGCTGAGATGAAAGTGGG + Intergenic
948698175 2:239744262-239744284 CAGTGGGCACAGATGGAAGGAGG + Intergenic
948707739 2:239805526-239805548 AAGGGGGCAGCGAGGGAAATTGG + Intergenic
948773436 2:240265426-240265448 GAGTGGGGAGAGAGGGAAAGAGG - Intergenic
1169207661 20:3749297-3749319 CTGTGGGCAGAGATGCAAGCAGG + Exonic
1169391605 20:5195569-5195591 CCTTGGCCAGAGCGGGAAGTGGG - Exonic
1170292160 20:14782709-14782731 GACTGGGCAGAGGGAGAAGTTGG - Intronic
1171412944 20:24958736-24958758 CACGGGGCAGGGAGGGGAGTGGG + Intronic
1171774076 20:29349586-29349608 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1171816077 20:29787140-29787162 CAGGGGGCAGAGAGGGGTGGTGG + Intergenic
1172703380 20:36865546-36865568 CAGTGGGCCGTGAGGGGAGCTGG - Intergenic
1172882116 20:38208866-38208888 CAGTGCACAGAGAGGGAAGCAGG + Intergenic
1173020276 20:39261394-39261416 CAGTGTGCAGAGTGGAAAGAAGG - Intergenic
1173297884 20:41775409-41775431 CAGACCGCAGAGATGGAAGTTGG + Intergenic
1173460992 20:43243281-43243303 CACTGGGCAGCGAGGGCAGATGG + Intergenic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173595057 20:44253669-44253691 CAGGGGGCAGAGATGGCAGATGG + Intronic
1173870877 20:46341473-46341495 GAGTGGGCAGGGAGGGACGGGGG - Intergenic
1173904190 20:46613822-46613844 CTGGGGGCAGAGGGGGAAGGAGG + Intronic
1174274386 20:49393122-49393144 CAGCAGGCAGAGATGGGAGTAGG + Intronic
1174421810 20:50404134-50404156 CGGTGGGCAGAGAGCAAGGTCGG - Intergenic
1174475501 20:50793301-50793323 CAGTGGACAGATTTGGAAGTGGG + Intergenic
1175224815 20:57439073-57439095 CAGAGGGCAGCTAGGGAAGCCGG - Intergenic
1175254037 20:57628132-57628154 GAGGGGGCAGGAAGGGAAGTGGG + Intergenic
1175499886 20:59442173-59442195 GAGTGGGGAGAAAGGGAAGGAGG - Intergenic
1175832729 20:61975665-61975687 CAGGGGGCAGAGAGGAGAGCGGG + Exonic
1175957259 20:62617793-62617815 CAGTGGTCAGTGAGGTCAGTGGG + Intergenic
1176886544 21:14263149-14263171 TAGTGAACAGAGAGAGAAGTCGG - Intergenic
1177674372 21:24277308-24277330 GAGTGGGGAGAGAGGGAGGGAGG - Intergenic
1178352287 21:31880868-31880890 CACTGGGCAGAGGGAGAAGCTGG + Intronic
1178523055 21:33302437-33302459 GATTGGGCAGAGGGAGAAGTTGG - Intergenic
1178870068 21:36366179-36366201 CAGTGGGGAGAGAGGAAGGGAGG - Intronic
1179049799 21:37879439-37879461 CAGTGGGCAGAGTGGTAAGGGGG + Intronic
1179170704 21:38970733-38970755 CCGTGGGAAGAGAGGGCAGGTGG - Intergenic
1179219024 21:39390128-39390150 CAGTTGGCAGAGGTGGGAGTAGG + Intronic
1179884444 21:44307551-44307573 CAGTGAGCAGTGAGGGGGGTGGG - Intronic
1180106772 21:45623762-45623784 CAGTGATGAGAGAGGGAAGAAGG - Intergenic
1180186638 21:46143323-46143345 GAGTGGGGAGAGAGGGAGGTGGG - Intronic
1180785887 22:18547564-18547586 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181131173 22:20733289-20733311 CTGTGGGCAGTGAGGGAGGAGGG - Intronic
1181242812 22:21487118-21487140 CTGTGGGCAGTGAGGGAGGAGGG - Intergenic
1181308868 22:21932948-21932970 CAGAGAGAAGAGAGGGAAGCTGG - Intronic
1181571122 22:23768215-23768237 CAGAGGGCAGGGAGCGGAGTTGG + Exonic
1181996083 22:26883842-26883864 CAGGGGCCAGAGAGGGGAGGCGG - Intergenic
1182268156 22:29135481-29135503 AAGTGTGAAGAGAAGGAAGTGGG + Intronic
1182676562 22:32043657-32043679 CTGTGAGCAGAGAAGGAAGGTGG + Intronic
1183167138 22:36156465-36156487 CAGGGAGCAGTGAGGAAAGTAGG - Intronic
1183259058 22:36782543-36782565 AAGGGGGCAGTGAGGGAAGGCGG - Intergenic
1183738506 22:39657139-39657161 CTGGGGGCAGTGGGGGAAGTTGG - Intronic
1184281739 22:43441336-43441358 CAGTGGGCAGAGGGGACAGTGGG - Intronic
1184552122 22:45210056-45210078 AAGAGGGCAGACAGGGAGGTGGG - Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949243169 3:1894910-1894932 CACTGGGAATAAAGGGAAGTTGG + Intergenic
949321534 3:2816422-2816444 TAGGGGGAAGAGTGGGAAGTGGG + Intronic
949539298 3:5019939-5019961 CTGTGGCCAGAGAGGAAAGGGGG - Intergenic
949576729 3:5345623-5345645 CAGGAGGCAGAGGGGGAACTGGG + Intergenic
950068666 3:10134700-10134722 GCTTGGGCACAGAGGGAAGTAGG + Intergenic
950094345 3:10319983-10320005 GAGTGGGGAGAGAGGGAGGGTGG + Intronic
950285574 3:11742218-11742240 CAGTGGGAGGGGAGGGGAGTGGG - Intergenic
950563624 3:13750747-13750769 CATTGTGCAGATGGGGAAGTTGG - Intergenic
951021639 3:17787297-17787319 GAGGAGGAAGAGAGGGAAGTGGG - Intronic
951456156 3:22894422-22894444 GAATGGGCAGAGGGAGAAGTCGG - Intergenic
951534676 3:23729862-23729884 GAGTGGGCAGGGTGAGAAGTAGG - Intergenic
951709318 3:25573175-25573197 GAGTGGGCAGGGAAGGAAGGCGG - Intronic
952255302 3:31690000-31690022 AGGTTGGCAGAGAGGGAAGAAGG + Intronic
953586761 3:44208029-44208051 CAGTGGGCCTAGAAGAAAGTGGG - Intergenic
953827003 3:46262046-46262068 CATGGGGCAGAGTGGGAAGGGGG - Intronic
953917655 3:46930845-46930867 GAGAGGGTAGAGAGGCAAGTGGG - Intronic
953920675 3:46949261-46949283 CAGTGGGGACAGAGGGACGGAGG + Intronic
954349096 3:50027498-50027520 CTGGGGGTAGAGAAGGAAGTAGG - Intronic
954695827 3:52425227-52425249 CAGTGGGTAGAAAGGGAGCTTGG + Intergenic
954794641 3:53155257-53155279 CAGTGGGCAGAGGCAGAAATTGG - Intergenic
954859609 3:53676291-53676313 TAGCAGGCAGAGAGGGAAGGTGG - Intronic
954971155 3:54652723-54652745 CAGTGGGCACAGTGAGATGTTGG + Intronic
955055951 3:55456310-55456332 CAGTGAGCAGAGAAGGCAGCTGG - Intergenic
955514535 3:59713655-59713677 CAGGAGACAGAGAGGGAAGTAGG + Intergenic
955591948 3:60546522-60546544 AAGTGGGGAGAGAGGGATGGTGG - Intronic
955881229 3:63548347-63548369 CATTATGCAGATAGGGAAGTTGG - Intronic
956012907 3:64850628-64850650 GGGTGGGCAGAGGGAGAAGTTGG + Intergenic
956276704 3:67509946-67509968 CAGTGGTGAGAGATGGAGGTGGG + Intronic
956455362 3:69415459-69415481 TAGAGGGCAGAGGGGGAAGAGGG - Intronic
956754085 3:72368374-72368396 CAGGGGGAAGAGAGGGAAGGTGG - Intergenic
957100096 3:75816495-75816517 GATTGGGCAGAGCAGGAAGTCGG + Intergenic
957226612 3:77456922-77456944 AAATGGGGAGAGAGGGAAATTGG - Intronic
957520938 3:81317392-81317414 CATTTGGCAGAGAGGGAGTTGGG + Intergenic
957698170 3:83671554-83671576 CAGGAGGAAGAGAGGGAAGGGGG - Intergenic
957790868 3:84939672-84939694 CACAGGGCAGAGAGGGAAGAAGG + Intergenic
958114777 3:89201586-89201608 CAGTGGTCAGAATGGGTAGTGGG - Intronic
959097954 3:101976169-101976191 TAGTGGGGAGAGAGGGAATGGGG + Intergenic
959107070 3:102076779-102076801 AAGTGGGGAGAGTGGGAGGTGGG - Intergenic
959256846 3:104025832-104025854 CAGGGGGCAGGGAGGGAAGGAGG + Intergenic
959537641 3:107504740-107504762 CATGGGGCAGAGAGGGAAAATGG + Intergenic
960004449 3:112767620-112767642 CAGGAGGGAGGGAGGGAAGTTGG - Intronic
960591409 3:119369271-119369293 CAGTTGGCAAAGAGGGATGAGGG + Intronic
961156129 3:124681165-124681187 AAATGGGCACAGAGGGATGTGGG + Intronic
961222063 3:125208989-125209011 CAGTGGGAAGACAGGCTAGTGGG - Intronic
961318739 3:126057895-126057917 CTGTGGGGACAGAGGGAAGAGGG - Intronic
961468088 3:127093503-127093525 GAGTGGGCAGAGCGCCAAGTGGG + Intergenic
961795477 3:129405806-129405828 CAGTGGTCAGAGATGGATTTGGG + Intronic
961999939 3:131285282-131285304 GAGTGGGTAGAGAGAGAAGGTGG + Intronic
962018305 3:131467595-131467617 CAGGAGGAAGAGAGGGAAGGGGG - Intronic
962161618 3:133006535-133006557 CAGAGGGCAGACAGGCAAGGGGG + Intergenic
962848484 3:139290391-139290413 CAATGGGCAGAGTGAGATGTAGG - Intronic
963442112 3:145354231-145354253 AAGTGAGAAGAGAGGGAAGAGGG + Intergenic
963692884 3:148526649-148526671 CTGGGGGCTGTGAGGGAAGTGGG + Intergenic
964334060 3:155636114-155636136 CAGTGAGATGTGAGGGAAGTTGG - Intronic
964416570 3:156454249-156454271 CACTGGGCAGACAGAGAACTTGG + Intronic
964496221 3:157293176-157293198 GAGTGGGTGGAGAGGGAGGTAGG + Intronic
964820003 3:160757815-160757837 CAGAGGGCAGAGAAGAAAGTTGG - Intronic
965291392 3:166886274-166886296 TAGTGGGGAGAGAGGGATATGGG + Intergenic
965612787 3:170562485-170562507 CAGTGGGGAGGGTGGGAAGGGGG + Intronic
965617653 3:170611425-170611447 ATGTGGTCAGAGAGGTAAGTTGG - Intronic
966080497 3:175994230-175994252 CATGGGGCAAAGAGGGAAGGAGG - Intergenic
966473101 3:180314398-180314420 AAGTGGGAAGAGAGGAAGGTGGG - Intergenic
967072139 3:185971497-185971519 CAGTGGGGAGAGGGGGTAGAGGG + Intergenic
967248398 3:187512522-187512544 CAGAGGGCAGAGAGGGAAAGAGG + Intergenic
967296186 3:187967376-187967398 CAGTGTGCAGGGATGGATGTGGG + Intergenic
969124997 4:4940573-4940595 CAGGAGGCAGAGAGGCAGGTGGG + Intergenic
969303459 4:6311031-6311053 CAATGGGCAGATAGGTAAGCGGG + Intergenic
969629933 4:8330117-8330139 CAGGGGACTGAGAGGGAAGTGGG + Intergenic
970502873 4:16696090-16696112 CCTTGGGGAGAGAGGAAAGTAGG + Intronic
971810268 4:31416332-31416354 CAGTGGGCTGAGATGGAGGGTGG + Intergenic
971947109 4:33294995-33295017 CAGTGAGCTGAGAGGGAGGGAGG - Intergenic
972662865 4:41133737-41133759 CAGTGGGGAGAGAGGGACCAAGG - Intronic
973740742 4:53917072-53917094 CAGTGGGCAGAGAGGCAGTGGGG - Intronic
974384793 4:61190302-61190324 CATTGGCAAGAGAGAGAAGTGGG + Intergenic
974710637 4:65589434-65589456 CAGTGGTTACAGAGGGAGGTGGG - Intronic
975163505 4:71150674-71150696 AAGTGTGCAGAGATGGAAATGGG + Intergenic
976142154 4:82003599-82003621 CAGGAGGAAGAGAGCGAAGTGGG - Intronic
976261467 4:83148948-83148970 ATGTGGGTAGAGAGGGAAGAGGG + Intergenic
976576347 4:86676851-86676873 GACTGGGCAGAGAGGGTAGAGGG + Intronic
977572338 4:98641777-98641799 CAGTGTGCAGAGGGGACAGTGGG - Intronic
977873015 4:102115606-102115628 TAGTTGGCAAAGAGGAAAGTGGG + Intergenic
978049016 4:104172096-104172118 GAGTGGGGAGAGTGGGAAGAGGG - Intergenic
978291995 4:107152554-107152576 CAGTGTGAAGAAGGGGAAGTTGG + Intronic
978314933 4:107425212-107425234 CAGGAGGGAGAGAGTGAAGTGGG + Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
979249673 4:118553106-118553128 CATTGGGCAGAGTAGGGAGTTGG - Intergenic
980750324 4:137078735-137078757 CTCTGGGAAGAGAGGGGAGTAGG - Intergenic
980825213 4:138064111-138064133 CAGTGGGCTGACAGGTGAGTGGG - Intergenic
981173602 4:141654151-141654173 GGGTGGGCAGAGGGAGAAGTTGG + Intronic
981186291 4:141807782-141807804 AAGTGGGCATACAGGGAAATGGG - Intergenic
982193937 4:152890267-152890289 CACTGAGCAGGGAGGGAAGAAGG + Intronic
983372565 4:166879895-166879917 CAGGAGGCAGAGAGAGAAGAGGG - Intronic
983453265 4:167932383-167932405 CAGTGTGCAGAGAGGTGACTTGG - Intergenic
983535843 4:168855995-168856017 AAGTGGGGAGAGAAGGAGGTGGG - Intronic
983551849 4:169025794-169025816 CAGTGAGCAGTGAGGGAGGACGG + Intergenic
984623909 4:181984069-181984091 AAGGGGACAGAAAGGGAAGTGGG - Intergenic
984766201 4:183402383-183402405 CACTGGGCAGAGAGGGAGGGTGG - Intergenic
984858861 4:184219286-184219308 CAGAGGGCAGAGGTGGAAGAGGG - Intronic
984941983 4:184940953-184940975 CAGTAGGCATAGGTGGAAGTGGG - Intergenic
985036670 4:185847375-185847397 CACTGGGCAGAGTGAGAATTTGG - Intronic
985045800 4:185939424-185939446 CAGCAGTCAGAGAGGGACGTGGG - Intronic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
985518933 5:361678-361700 CAGTAGGAAGAGAGGGGAGACGG - Intronic
985521367 5:375390-375412 CAGTGGGGAGTGAGGGTGGTGGG + Intronic
985625066 5:981600-981622 GAGGGGGCAGAGTGGGAAGAAGG + Intergenic
985658131 5:1142495-1142517 GAGAGGGGAGAGAGGGGAGTGGG - Intergenic
986275559 5:6272182-6272204 CACTGGGCAGAAGGAGAAGTTGG - Intergenic
986547482 5:8914345-8914367 CAGTAGGAAGAGAGCAAAGTGGG + Intergenic
986549888 5:8940810-8940832 CAGAGGGAAGAGAGAGAAATGGG + Intergenic
988011963 5:25500438-25500460 TAGAGGGGAGAGAGGGAAGAAGG - Intergenic
988786572 5:34570727-34570749 CAGTGGGAAGAGAGGAAGGGCGG + Intergenic
989481668 5:41937763-41937785 CAGAAGGCAGAAAGGGAAGCGGG + Intronic
990355839 5:54965384-54965406 CAGTGGACAGAAAGGAGAGTGGG + Intergenic
990527045 5:56638414-56638436 TGGTGGGCAGAGCGGGAAGGTGG - Intergenic
991157553 5:63457450-63457472 AAGTGGGCAAATTGGGAAGTGGG - Intergenic
991320558 5:65368980-65369002 CAGGAGGCAGAGTGGGCAGTGGG + Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
993735982 5:91477273-91477295 CAGTAGGAAGAGGAGGAAGTGGG - Intergenic
994285319 5:97957571-97957593 AAGTGGGCAGAGAGGGAAAAAGG - Intergenic
995126935 5:108586885-108586907 GGGTGGGGAGAGAGGGAAGGGGG + Intergenic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
996646535 5:125824892-125824914 CAGAGGGCAGAGAGGAAACTAGG + Intergenic
996884745 5:128341701-128341723 AAGTGGGCAGAGAAAGAAATGGG - Intronic
996885959 5:128353985-128354007 CAGTGGGGAGACAGGGAGGGAGG - Intronic
996930030 5:128875141-128875163 CAGAAGGCAAAGAGGGAAGCCGG - Intronic
997234476 5:132264864-132264886 AAGAGGGCAGATAGGGAAGCTGG - Intronic
998114703 5:139527281-139527303 CTGTGGGGAGAGGGGGAAGGGGG - Intronic
998157210 5:139793872-139793894 CATTGGGCAGATGAGGAAGTAGG + Intergenic
998262400 5:140641592-140641614 AAGTGGGCAGAGAGAGACTTAGG + Intronic
998386521 5:141760241-141760263 CGGTGGGCTGAGATGGGAGTAGG + Intergenic
998543778 5:143008052-143008074 AAGTGGGAAGAGAAGGAAGGAGG + Intronic
1000570846 5:162912177-162912199 GAGTGGGGCGAGAGGGAAGTGGG - Intergenic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1002123133 5:177021475-177021497 GAGTAGCCAGAGAAGGAAGTGGG + Intronic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002370736 5:178752037-178752059 AAGCAGGCAGAGAGGGAAGGAGG - Intergenic
1002910704 6:1489037-1489059 CAGTAGGAAGAGAGTGAAGGGGG - Intergenic
1003242120 6:4353927-4353949 GTGAGGGCAGAGAGGGAAGAAGG - Intergenic
1003860669 6:10319389-10319411 CCGTGGGGATAGAGGGACGTGGG + Intergenic
1003869431 6:10390379-10390401 GAGCGGGCAGGGAGGGGAGTAGG + Intergenic
1003972173 6:11310306-11310328 CAGTGGGCAGAGAGGGAAGTGGG - Intronic
1004302226 6:14469033-14469055 CAGTGGGCAGAGAGCAAGGAAGG - Intergenic
1004510050 6:16277884-16277906 CAGTGGGGAGGGAGGGGAGCAGG + Intronic
1004976509 6:20973413-20973435 CAGTGAGCGGGGAGTGAAGTAGG + Intronic
1005036634 6:21561373-21561395 CAGTGGGCAGGGCTGGAAGTGGG - Intergenic
1006093949 6:31644379-31644401 CAGGGGGCAGGGAGGGCAGCTGG + Intronic
1006343367 6:33459723-33459745 CAGCGGGCAGAGGTGGAAGTTGG - Intergenic
1006372446 6:33653775-33653797 CAGTGGGCAGGGAGTGATTTGGG - Intronic
1007387208 6:41528096-41528118 AACTGGGCGGGGAGGGAAGTGGG - Intergenic
1007496626 6:42264444-42264466 CAGGAGGCAGAGAGAGAAGCTGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1009026950 6:58011527-58011549 CATTTGGCAGAGAGGAAAATTGG + Intergenic
1009202491 6:60762998-60763020 CATTTGGCAGAGAGGAAAATTGG + Intergenic
1009370125 6:62889123-62889145 CCGTGGGAAGAGAGAGAAGAGGG + Intergenic
1009401027 6:63256003-63256025 GAGTGGGCAGAGAAAGGAGTTGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009988926 6:70817019-70817041 AAGTGGGAAGAGATGGAACTGGG - Intronic
1011443505 6:87412419-87412441 GAGTGAGCAGTGAAGGAAGTGGG + Intronic
1012499688 6:99875078-99875100 CGGTGGGCAGAGTGGGAGGGAGG - Intergenic
1012995998 6:105975476-105975498 CAATGGGCTGAGAGGGAGGCAGG + Intergenic
1013523801 6:110956241-110956263 CAGGGGGCAGAGATTGCAGTGGG + Intergenic
1013542916 6:111129251-111129273 AAGTGGGCAAAGAAGGAAGGGGG + Intronic
1013544229 6:111140004-111140026 GAGTGGGAAGAGTGGGAAGAGGG + Intronic
1013838701 6:114363589-114363611 CATTTGGCAGAGAGGCAAGTTGG + Intergenic
1014126649 6:117783644-117783666 CAGTGGGCAGAGAGGTCCGTGGG - Intergenic
1014140242 6:117933666-117933688 CAGTGGGAAGAGAGAGAGCTGGG - Intronic
1014203694 6:118631803-118631825 GAGGGGGCAGAGAGAGAAGTGGG + Intronic
1014828608 6:126075482-126075504 CAGGGGGAAGAGAGATAAGTGGG - Intergenic
1015050839 6:128837599-128837621 CAGTAGGAAGAAAGTGAAGTGGG - Intergenic
1015633741 6:135255765-135255787 CAGTGGGCTGAGAGTAAAGAAGG - Intergenic
1016264192 6:142212761-142212783 CAGGAGACAGAGAGGGAAGGGGG + Intronic
1016568053 6:145480302-145480324 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1016832262 6:148445702-148445724 CAGGGCGAAGAGAGGGAAGAAGG + Intronic
1016839464 6:148511834-148511856 CAGTGGGCAGTAAGAGAAATGGG - Intronic
1016863633 6:148746387-148746409 CAGTGCCCAGAGAGGCAAGTGGG - Intergenic
1018964373 6:168473155-168473177 CAGTGGACAGAGCAGGGAGTGGG + Intronic
1019075869 6:169387757-169387779 CTGTAGGCAGAGAGGCAGGTAGG - Intergenic
1019113746 6:169739484-169739506 CTGTGGGGAGAATGGGAAGTTGG + Intergenic
1019273167 7:161923-161945 CAGCGGGCAGAGCGGCTAGTCGG + Intergenic
1019481484 7:1268914-1268936 CAGGTGTCAGGGAGGGAAGTGGG - Intergenic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020777627 7:12474188-12474210 GAGGGGCCAGAGAAGGAAGTGGG + Intergenic
1021123147 7:16819717-16819739 GAGTGGGGAGGGAGGGAAGAGGG - Intronic
1021742081 7:23696970-23696992 CAGGGGGCAGAGCTGGAGGTGGG + Intronic
1021840326 7:24717133-24717155 CTGTGGGAAGAGAGGGAAAGAGG - Intronic
1022717345 7:32910547-32910569 GATTGGGCAGAGGGAGAAGTTGG + Intergenic
1022785138 7:33631143-33631165 GAGTGTGCAGAGTGGTAAGTTGG + Intergenic
1022798609 7:33753437-33753459 CAGTGGGCAAAGAGGCAGGAGGG - Intergenic
1023709287 7:42974748-42974770 GCGTGGGCACAGAGGGAGGTTGG + Intergenic
1023849162 7:44140680-44140702 CAGTGCGCAGGGTGGGAGGTGGG + Intronic
1023863138 7:44227202-44227224 CAGGGGACAGAGGGGGATGTGGG + Intronic
1024020470 7:45363645-45363667 CAGTGGACAGACAGGAAAGCAGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024248843 7:47491125-47491147 CAGTGGGCAGAGAGGCAGAGGGG + Intronic
1024337529 7:48224492-48224514 CAGTGGGGAAAGAGGGAAAGAGG - Intronic
1025002742 7:55331123-55331145 GAGTGGGAGGGGAGGGAAGTTGG - Intergenic
1026019161 7:66694683-66694705 CAGTAGGGAGAGAATGAAGTCGG + Intronic
1028428103 7:90713553-90713575 TTGTGGGGAGAGAGGGAAGATGG + Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1029793701 7:102871907-102871929 CTGGGGGCAGGGAGGGAAATAGG - Intronic
1030120445 7:106105485-106105507 TGGTGGGCAGAGAAGTAAGTGGG - Intronic
1030380358 7:108803946-108803968 CAGGGGGGAGAGAGGGAAGCAGG - Intergenic
1031489607 7:122370619-122370641 AAGTGGGCACAGAGGGCATTGGG + Intronic
1031669561 7:124526093-124526115 CAGAGGGCAAAGATGGAACTGGG - Intergenic
1032203964 7:129845491-129845513 CAGTGTGCAGAAAAGAAAGTGGG - Intronic
1032228435 7:130052754-130052776 CAATGGGCAAAGAGGAAAGTGGG + Intergenic
1032489441 7:132313107-132313129 AGGTAGGCAGAGAGGGAGGTTGG - Intronic
1033546838 7:142408977-142408999 TAGTGGGCAGACAAGGAAGTAGG - Intergenic
1033648801 7:143324364-143324386 CAGGTGGAAGAGAGGGAGGTGGG - Intronic
1034065830 7:148135958-148135980 CATTGGGAAGAGAGGGAGGAAGG + Intronic
1034213385 7:149384108-149384130 CCCTGGGAAGAGTGGGAAGTTGG - Intergenic
1034458065 7:151182246-151182268 CAGTGGGCACACATGGAAATGGG + Intronic
1034847523 7:154460373-154460395 CAGAGTGAAGAGACGGAAGTGGG - Intronic
1035282676 7:157787472-157787494 CAGTGGGCAGGGCGGGCAGGGGG + Intronic
1036010544 8:4717075-4717097 CTCGGGGCAGAGAGGGAAGAAGG - Intronic
1036950691 8:13136325-13136347 GAGTGGGGAGAGAGGGAGGAAGG - Intronic
1037475321 8:19251465-19251487 CAGAGAGTGGAGAGGGAAGTGGG + Intergenic
1037565991 8:20118965-20118987 CAGGGGGAAGAGAGAGAAGGGGG - Intergenic
1037588788 8:20295944-20295966 GAGAGGGGAGAGAGGGAAGGAGG - Intronic
1037606603 8:20443015-20443037 CAGTAGCTAGAGAGGGAACTGGG + Intergenic
1038158080 8:25009668-25009690 CTGTGAGCAGAGAGGGAGATGGG - Intergenic
1038871254 8:31496370-31496392 CAGTGGGCACAGAGTGAGGGAGG + Intergenic
1039021923 8:33217463-33217485 AAGTGGATAGAGTGGGAAGTTGG - Intergenic
1039366660 8:36935183-36935205 CAGTGGGAAGAGGGGGAAGACGG - Intronic
1040064454 8:43133765-43133787 CAGGGGGCAAAGAGGAAAGAGGG + Intergenic
1040341953 8:46445557-46445579 CAGCAGGCAGAGAGGGAAAGCGG - Intergenic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040698294 8:50029500-50029522 CAGAGGGCAGGAAGAGAAGTGGG - Intronic
1040899644 8:52404627-52404649 CAGGGGGCAGTGAGGGAAAGAGG - Intronic
1040960291 8:53024769-53024791 GACTGGGGAGAGAGGGAAGGAGG - Intergenic
1041192427 8:55367133-55367155 CGGTGGGCACACAGGGAAGGAGG - Intronic
1041386797 8:57312787-57312809 CAGAAGGAAGAGAGTGAAGTAGG - Intergenic
1041648507 8:60277989-60278011 CAGTGGGCAGGGGTGGAAGAAGG + Intronic
1041796896 8:61754352-61754374 AAGGGGGCAGAGAGGAAAGAGGG - Intergenic
1041878226 8:62715084-62715106 CAGAGGAGAGAGAGAGAAGTAGG + Intronic
1042765416 8:72315850-72315872 CAGGAGACAGAGAGGGAAGAGGG + Intergenic
1042942123 8:74118381-74118403 AGGTGGGGAGAGAGGGAAGAAGG - Intergenic
1043814212 8:84781693-84781715 CAGTGGGAATTGAGGGAGGTGGG + Intronic
1044211762 8:89558969-89558991 GAGTGGATAGAGAAGGAAGTGGG - Intergenic
1046104498 8:109649421-109649443 CTTGGGGCAGAGAGGGCAGTGGG + Intronic
1047182296 8:122600630-122600652 GAATGGGGAGAGAGGGAAATGGG + Intergenic
1047408701 8:124606631-124606653 CATTTGGCAGATAGGGAATTAGG + Intronic
1047545366 8:125811362-125811384 GGGTGTGCAGAGTGGGAAGTGGG + Intergenic
1047657608 8:126995428-126995450 AAAGGGGCAGAGAGGGAAGGAGG - Intergenic
1047858908 8:128942837-128942859 CAGTGTGGAGATATGGAAGTAGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048233693 8:132669116-132669138 AATTGAGCAGAGGGGGAAGTTGG - Intronic
1048235582 8:132686658-132686680 CAGTGGTGATAGAGGGAAGTGGG + Intronic
1048278849 8:133089802-133089824 GAGTGGGCAGGGATGGCAGTGGG - Intronic
1048334052 8:133490094-133490116 CTTTGGGCAGAGAAGGAAGTTGG + Intronic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1048798407 8:138172865-138172887 GAGTGGGCAGGGAGGGGAATGGG - Intronic
1048934715 8:139345288-139345310 CAGTGAGCAGACAGGGATTTGGG - Intergenic
1048972863 8:139655005-139655027 CAGTGGACAGAGATGGATGGCGG + Intronic
1049004073 8:139843811-139843833 CAGAGGGCAGAGTCAGAAGTGGG - Intronic
1049150989 8:141035446-141035468 CAGTGGGGAGCGAGGGCAGGAGG - Intergenic
1049152480 8:141044237-141044259 CAGAGGGTAGAGTGGGAAGCTGG - Intergenic
1049227888 8:141466378-141466400 GAGTGGGCAGTGAGGCAAGAGGG + Intergenic
1049233296 8:141495284-141495306 CAGGGGGCAGAGGGGGAGGGTGG - Intergenic
1049610230 8:143551743-143551765 CAGTGGGGAGAGTGGGATGAGGG - Intergenic
1049747506 8:144269231-144269253 CAGTGGGCACAGAGAGAAGAAGG + Intronic
1049850779 8:144829136-144829158 CAGTGGGCAGAGCAGGAGGTGGG - Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050431780 9:5569470-5569492 CAGTGGGTTGAGAGAGAGGTTGG - Intronic
1050475364 9:6034979-6035001 CAGTGGGGAGAGGGGGAAGCGGG - Intergenic
1050933796 9:11366903-11366925 GCGTGGGCAGAGAGGGGAGAGGG + Intergenic
1051343096 9:16129215-16129237 GACTGGGCAGAGGGAGAAGTGGG + Intergenic
1051823309 9:21192668-21192690 CAGTGAGCAGATAGGGGATTAGG - Intergenic
1053008179 9:34618129-34618151 GAGTGGAGAGATAGGGAAGTGGG - Intronic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1055068231 9:72140397-72140419 AAGAGGGCAGAGAGAGAAGTTGG + Intronic
1055449503 9:76418132-76418154 AAGTGGGCAGAGAGGGGAGGAGG + Intergenic
1056114565 9:83429518-83429540 AGGTGGGCAGAGAAGGGAGTGGG - Intronic
1056372551 9:85971855-85971877 CAGTGGGGAGAGTAAGAAGTTGG - Intronic
1056751322 9:89353494-89353516 CACTGGGCAAAGAGGCAACTCGG - Intronic
1056944561 9:90983508-90983530 CAGGGGGTGGAGAGAGAAGTAGG - Intergenic
1057267602 9:93629639-93629661 CAGGGGGCAGGGAAGGAAGAGGG - Intronic
1057398929 9:94705156-94705178 TAGTGGGAGGGGAGGGAAGTAGG - Intergenic
1058061968 9:100507014-100507036 CAGTGGGGAGAGAGGGAGAAAGG - Intronic
1059340876 9:113597005-113597027 CAGGGGGCAGGGAGGCAGGTGGG - Exonic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1060404214 9:123365187-123365209 CAGTGGGCAGAGATTGCAGTGGG + Intronic
1061022175 9:128023058-128023080 CAGAGGGTAGAGGAGGAAGTGGG - Intergenic
1061060884 9:128250088-128250110 GAGTAGGCAAAGAGGGAAGGAGG - Intronic
1061422445 9:130479690-130479712 GGGTGGGAAGAGAGGGCAGTGGG - Intronic
1061459489 9:130725235-130725257 AAGTGGGGAAAGAGGGAAATGGG - Intronic
1062362757 9:136195450-136195472 CAGTGGACGGGGAGGGAAGGTGG - Intergenic
1062374531 9:136255945-136255967 CAGGTGGCAGAGAGGGGGGTGGG + Intergenic
1186007882 X:5094483-5094505 CAGTGAGCAGAGGGGGGACTTGG + Intergenic
1186137003 X:6532715-6532737 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186267282 X:7844583-7844605 ATGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186297707 X:8169068-8169090 GTGTGGGGAGGGAGGGAAGTGGG - Intergenic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186325152 X:8467403-8467425 GTGTGGGGAGGGAGGGAAGTGGG + Intergenic
1186393696 X:9186373-9186395 CAGTGAGAAGGGAGGGAAGCAGG + Intergenic
1186669759 X:11757546-11757568 CAGTGGGCAGCGAGGCAGATGGG - Intergenic
1187146195 X:16639602-16639624 CACTGGGCAGTGGGGGAAGAGGG - Intronic
1187178576 X:16919770-16919792 CAGAAGGCAGAGAGGAAAGATGG + Intergenic
1187244150 X:17538894-17538916 CAGTGGCTAGACAGGGAAGCAGG - Intronic
1187245616 X:17550696-17550718 AGGTGGGCAGAGGGGGAAGTGGG - Intronic
1187380415 X:18796688-18796710 CAATGAGGAGAGAGAGAAGTGGG + Intronic
1187614305 X:20976497-20976519 GAGTAGACAGAGAGGGAAATCGG + Intergenic
1188518326 X:31011122-31011144 CAGTGGGCAGGAGAGGAAGTTGG + Intergenic
1189285240 X:39847514-39847536 CAGTGGGCAGTAGGGGAGGTAGG + Intergenic
1189308180 X:40002943-40002965 CAGGGTGCAGAGAGGGGAGGAGG + Intergenic
1189475739 X:41353879-41353901 CAGTGGGTAGAGAAAAAAGTAGG + Intronic
1189568937 X:42274476-42274498 GAGTGGGCAGAGAGAGGAGTGGG - Intergenic
1190054712 X:47174906-47174928 CGGGGGGCAGAGAGGGAAAGGGG - Intronic
1190067386 X:47250794-47250816 CAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1190195455 X:48314222-48314244 CAGAGGGCAGAGGGAGAGGTAGG - Intergenic
1190209047 X:48429749-48429771 CAGAGGGCAGAGGGAGAAGTAGG + Intergenic
1190491886 X:50990624-50990646 CTGAGGGCAGAGAGGGAGGCAGG - Intergenic
1190501276 X:51081056-51081078 CTGAGGGCAGAGAGGGAGGCAGG + Intergenic
1190656554 X:52617870-52617892 CAGAGGGCAGAGAAAGAGGTAGG - Intergenic
1190662740 X:52669585-52669607 CAGAGGGCAGAGGGAGAGGTAGG + Intronic
1190676691 X:52788898-52788920 CAGAGGGCAGAGGGAGAGGTAGG - Intronic
1190741105 X:53289331-53289353 CAGTGGGGAGCTGGGGAAGTTGG - Intronic
1190741471 X:53291728-53291750 GAGTGGGGTGAGAGGGCAGTTGG - Intronic
1192325239 X:70126396-70126418 AGGAGGGCAGAGATGGAAGTTGG + Intergenic
1192496136 X:71617734-71617756 CAGTGGGCAGAGAGGGCTCTGGG - Intronic
1192545340 X:72008238-72008260 CACTGAGCAGATAGGGACGTGGG - Intergenic
1192755239 X:74040229-74040251 CAGGAGGAAGAGAGTGAAGTGGG + Intergenic
1193261361 X:79410333-79410355 CATTTGGCAGATAGGGAAGCTGG - Intergenic
1193644263 X:84047597-84047619 CAGTGGGCTTGGAGGGGAGTGGG - Intergenic
1193746465 X:85288440-85288462 CAGTGGGCACTGAGGGGAGGTGG - Intronic
1194310556 X:92301099-92301121 CAGTGGGGAGAGGGTGCAGTTGG + Intronic
1194649831 X:96501304-96501326 GAGTGGGGAGAGAGGGAATGAGG - Intergenic
1194970339 X:100336258-100336280 CAGTGAGGAGAGAGGTGAGTCGG + Intronic
1195306154 X:103585802-103585824 CAGTGGGCAGAGGGTGAGGAAGG + Intronic
1195318747 X:103704002-103704024 GAGAGTGCAGAGAGGCAAGTGGG + Intergenic
1195375588 X:104224441-104224463 CAGAGGCCAGAGAGGGGAGTTGG + Intergenic
1195626075 X:107006673-107006695 AACTGGGCAGAGGAGGAAGTGGG + Intergenic
1195696092 X:107668724-107668746 CAGTGGGCAGATGGGGCTGTAGG - Intergenic
1196309651 X:114148609-114148631 CAGTGGGCTGTGAGGGATGAAGG + Intergenic
1196865202 X:120065075-120065097 CAGGGGGCAGAGGAGGAAGCAGG + Intergenic
1196877891 X:120171205-120171227 CAGGGGGCAGAGGAGGAAGCAGG - Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197027585 X:121773507-121773529 AAGTGGGGAGAGAGGGAGGATGG - Intergenic
1197926061 X:131647696-131647718 CACTGTGCAGAGAGGGAAAAGGG - Intergenic
1198137837 X:133771795-133771817 CTCTGGGCAGAGAGGGAAGAAGG + Intronic
1198314629 X:135453169-135453191 CATGGGGCAGAGAGGGAGGCAGG - Intergenic
1198380321 X:136077628-136077650 CAGTTCTTAGAGAGGGAAGTGGG - Intergenic
1198587924 X:138143387-138143409 CAGTAGTCAGAAAGGGAAATTGG + Intergenic
1198818724 X:140622157-140622179 CAGGAGGAAGAGAGGGAAGGGGG + Intergenic
1200118415 X:153779256-153779278 CAATGGGGAGAGGGGGAAGGAGG - Exonic
1200618839 Y:5415385-5415407 CAGTGGGGAGAGGGTGCAGTTGG + Intronic