ID: 1003974177

View in Genome Browser
Species Human (GRCh38)
Location 6:11327096-11327118
Sequence ACATAGGGACTGTACTGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003974172_1003974177 9 Left 1003974172 6:11327064-11327086 CCTACTGGTGATGATGCTGGGAC 0: 1
1: 0
2: 0
3: 11
4: 149
Right 1003974177 6:11327096-11327118 ACATAGGGACTGTACTGGTGTGG 0: 1
1: 0
2: 0
3: 4
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003974177 Original CRISPR ACATAGGGACTGTACTGGTG TGG Intronic
904674888 1:32192870-32192892 ACATAGGTACTGTGCAGGTCCGG - Intronic
904811780 1:33167965-33167987 TCATAGGGACTAGTCTGGTGGGG + Intronic
910496934 1:87840384-87840406 ACATATGGTGTCTACTGGTGAGG + Intergenic
912616793 1:111110073-111110095 ACCCAGGTACTGTACTGGTCTGG - Intergenic
913319278 1:117577122-117577144 GCACAGGTACTGTCCTGGTGTGG + Intergenic
916288042 1:163132494-163132516 AAATAGGGAGTGTTCTAGTGGGG - Intronic
921844026 1:219860220-219860242 CCAGAGGGACTGTAGTGGTAGGG - Intronic
921850216 1:219926523-219926545 CCAAAGGGAGTGTTCTGGTGAGG - Intronic
922814965 1:228442181-228442203 ACATAGAGACAGTCCAGGTGAGG - Intergenic
1069877742 10:71573639-71573661 ACAAAGGAACAATACTGGTGAGG - Intronic
1074671005 10:115790928-115790950 ATATAGGAACTGCACTGGTTTGG - Intronic
1079627134 11:22629390-22629412 CCATAGAGGCTGTACTGGTTTGG + Intronic
1080437351 11:32257578-32257600 TCATAGGCATTGAACTGGTGAGG + Intergenic
1081244734 11:40750638-40750660 ACATCGGGACTGTTGTGGGGTGG + Intronic
1081872345 11:46389204-46389226 ACTGAGGGACTGTCCAGGTGAGG + Intergenic
1083044017 11:59716060-59716082 ACATAGGTACTGTCCTGGTCTGG - Intronic
1086879491 11:92137007-92137029 TGATAGGGAATGTGCTGGTGAGG - Intergenic
1087821626 11:102718955-102718977 TCACAGGGACTCTACTCGTGAGG - Intronic
1090209130 11:124905073-124905095 ATATAGTGACTGTATTGGTCAGG + Intergenic
1094311168 12:29085636-29085658 ACAAATGGACTGCTCTGGTGTGG + Intergenic
1096022628 12:48334846-48334868 CCATAGGGAGGGTACAGGTGCGG - Intergenic
1099327718 12:81240992-81241014 ACATGGGGACTGTTGTGGGGTGG - Intronic
1100142000 12:91630702-91630724 ACATATGGACTGTGCTGTAGTGG + Intergenic
1103725067 12:122993656-122993678 ACTTAGGGACAGTACCGTTGTGG - Intronic
1108520202 13:51240057-51240079 AGATAGAAACTGTACTGGAGTGG - Intronic
1108621832 13:52192476-52192498 ACATAGCTACTGTACTCGGGAGG + Intergenic
1119551327 14:75515969-75515991 ACAGGGGGACTGAACTGGTAAGG + Intergenic
1119898486 14:78240462-78240484 AGATAGGGACTGTTATGGGGAGG + Intergenic
1122009086 14:98730939-98730961 ACGTACTGACTGTCCTGGTGTGG + Intergenic
1124551582 15:30685824-30685846 CCAGAGGGAGTGTGCTGGTGGGG + Intronic
1124679664 15:31719837-31719859 CCAGAGGGAGTGTGCTGGTGGGG - Intronic
1125383203 15:39109637-39109659 GCATAGGTAATGTAGTGGTGAGG - Intergenic
1126775258 15:52094751-52094773 ACATGGGGACTGTAGTGCTTTGG + Intergenic
1127277688 15:57461592-57461614 ACATGGGGACTGAACTGGAGGGG + Intronic
1133898925 16:9954956-9954978 ACATAGTGACTGTGATGATGTGG + Intronic
1138091715 16:54180156-54180178 ACAAAGGGACTGAACCAGTGAGG - Intergenic
1143730574 17:8880564-8880586 AGAGAGGGACTGTCCTGGAGGGG + Exonic
1146975321 17:37106585-37106607 ACACAGGGACGGGACTGATGGGG - Intronic
1147115808 17:38298610-38298632 ACATCTGGCCTGTACAGGTGAGG + Exonic
1148413868 17:47491009-47491031 ACATCTGGCCTGTACAGGTGAGG - Intergenic
1157076882 18:44476265-44476287 ACAGAGGGAGTGATCTGGTGTGG - Intergenic
1162320388 19:9968091-9968113 ACATCGGGTCAGTATTGGTGGGG + Intronic
1163713054 19:18858346-18858368 ACCTAGAGACTTTTCTGGTGAGG + Intronic
925579639 2:5397430-5397452 ACTTAGGGACTGTATTAGTTAGG - Intergenic
926344914 2:11936262-11936284 CAATAGGGACTGTCCTGGTCTGG - Intergenic
935181273 2:100693096-100693118 ACATGGGGACAGCAGTGGTGGGG - Intergenic
937611241 2:123864140-123864162 ACATAGGGACTGTACACTTAAGG - Intergenic
943284301 2:185977361-185977383 ACATGGGGACTGTTGTGGGGTGG + Intergenic
946500879 2:220245945-220245967 ACATGGGTATTGTCCTGGTGTGG + Intergenic
947479575 2:230486337-230486359 ACATAGGGCCTGTTGTGGGGTGG - Intronic
947691895 2:232145995-232146017 GGATAGGGACAGTACTGATGAGG + Intronic
1169924159 20:10765699-10765721 AAATAGGGAATCTACTGGTCGGG + Intergenic
1172174874 20:32966213-32966235 AAATAGAGTCTGGACTGGTGAGG - Intergenic
1174473854 20:50782052-50782074 ACATAGGGATGGTACAGATGGGG - Intergenic
1180050378 21:45328389-45328411 ACACAAGGACCGTACTGGGGCGG - Intergenic
1185417738 22:50719629-50719651 ACATGGGGACAGAACTGCTGAGG - Intergenic
950795699 3:15509294-15509316 ACAGAGGGTCTGTTCTGATGTGG + Intronic
950897994 3:16470773-16470795 ACATTGTGACTGTGATGGTGTGG - Intronic
951580357 3:24156834-24156856 ACATAGGGAAGGTGCTGGTGGGG - Intronic
956717347 3:72089890-72089912 ACATATGGAATGTACAAGTGGGG + Intergenic
967235124 3:187376722-187376744 ACATAGTGCCAGTACTGGAGTGG + Intergenic
968506798 4:974490-974512 TCCTAGGGGCTGTGCTGGTGAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
990981896 5:61609199-61609221 ACATAGTGACTGTACGGTTGAGG + Intergenic
991129075 5:63100879-63100901 ACATAAGGACTGTATTAGTTAGG + Intergenic
991357591 5:65785312-65785334 ACATAGAAAATGTGCTGGTGAGG - Intronic
999201588 5:149820568-149820590 TCATCGGGGCTGTACTGGTTGGG - Exonic
1003974177 6:11327096-11327118 ACATAGGGACTGTACTGGTGTGG + Intronic
1007882706 6:45185299-45185321 ACAAAGAGACTGTACAAGTGGGG + Intronic
1013017882 6:106177662-106177684 GCATAGGGACTGTAGTTCTGAGG + Intergenic
1023082143 7:36535890-36535912 ACATTGGGATTCTACTGATGTGG - Intronic
1024000467 7:45185988-45186010 ACAAAGGGAATGTGCTTGTGTGG + Intronic
1024962969 7:54996815-54996837 ACATAGAGAATGAACTGGGGGGG - Intergenic
1029327951 7:99825832-99825854 TCATAGGGACAGAACTGCTGAGG + Intergenic
1030169798 7:106589597-106589619 ACATAGGGTGTGTACCTGTGAGG + Intergenic
1030659908 7:112207189-112207211 ACCAAGGCAGTGTACTGGTGAGG - Intronic
1032688200 7:134256994-134257016 AGATGGGGACTGCACTGGTCAGG + Intronic
1033467995 7:141614353-141614375 ACATGGGGACTTTTCTGGTTTGG + Intronic
1037504906 8:19519906-19519928 CCTTGGGGACTGTGCTGGTGGGG - Intronic
1037512019 8:19593336-19593358 ATATAGGGACCTTACTGGTAAGG + Intronic
1038768308 8:30451359-30451381 ACATAGTGTCTGTACTCATGGGG + Intronic
1040755755 8:50772088-50772110 ACCTAGGCATTGTGCTGGTGAGG - Intronic
1045172808 8:99689033-99689055 AAAAAGGGACTGTTCAGGTGTGG + Intronic
1055057291 9:72035628-72035650 AGATAAGGAATGTGCTGGTGAGG + Intergenic
1058321525 9:103636916-103636938 ACATAGAGTCTGGAGTGGTGAGG + Intergenic
1058735212 9:107887770-107887792 ACAGAGGGACTTTGCTGCTGTGG - Intergenic
1059976991 9:119728292-119728314 ACAAAGTGTCTGTGCTGGTGTGG + Intergenic
1062347802 9:136123395-136123417 ACAGAAGGACGGTACTGGAGGGG - Intergenic
1199158537 X:144579390-144579412 ATATTGGGACTGTAGTGGAGGGG + Intergenic
1199823431 X:151473791-151473813 ACATATGTACTATTCTGGTGGGG - Intergenic
1201209975 Y:11671150-11671172 ACATATGGAGTGTATTGGAGTGG + Intergenic
1201523447 Y:14903347-14903369 ACCTAGGGACTAGACTGGAGTGG + Intergenic