ID: 1003977784

View in Genome Browser
Species Human (GRCh38)
Location 6:11360217-11360239
Sequence CACCCTCTTCACCCTAATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003977784_1003977789 -6 Left 1003977784 6:11360217-11360239 CCCCCATTAGGGTGAAGAGGGTG 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1003977789 6:11360234-11360256 AGGGTGTGACATATGAGGAAAGG 0: 1
1: 0
2: 1
3: 25
4: 243
1003977784_1003977790 -5 Left 1003977784 6:11360217-11360239 CCCCCATTAGGGTGAAGAGGGTG 0: 1
1: 0
2: 1
3: 6
4: 113
Right 1003977790 6:11360235-11360257 GGGTGTGACATATGAGGAAAGGG 0: 1
1: 0
2: 1
3: 23
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003977784 Original CRISPR CACCCTCTTCACCCTAATGG GGG (reversed) Intronic
902247681 1:15131998-15132020 CTCCCTCTTAACCCAAATGTTGG - Intergenic
902860118 1:19239261-19239283 CACCGTCTTCTCCCCAGTGGTGG + Exonic
910846212 1:91606727-91606749 CACATTCTTCACCCACATGGTGG - Intergenic
912543357 1:110433504-110433526 CTCCCTCTCCACCCTAATGGAGG + Intergenic
913354054 1:117898798-117898820 CAACATTCTCACCCTAATGGAGG - Intronic
914258919 1:145982650-145982672 CCCCCTCATAACCTTAATGGGGG + Intergenic
924230448 1:241958000-241958022 CAACATCTTCACCCTGCTGGGGG + Intergenic
1065567933 10:27033947-27033969 CACCATTTTCACACTAATGAGGG - Intronic
1065688125 10:28306319-28306341 CTATCTCTTCACCCTAATAGAGG + Intronic
1066632408 10:37469910-37469932 CACCCTCTTGATCCCCATGGAGG - Intergenic
1067748244 10:48952665-48952687 CACCCTCCTCCTCCTAATGCAGG + Intronic
1073343576 10:102764654-102764676 CACCCTCTACAACTTATTGGAGG + Intronic
1074105974 10:110389972-110389994 CACCCTCCTCTCCCTCATGATGG + Intergenic
1080388336 11:31823404-31823426 AACCATCTTCACCCCAAAGGAGG + Intronic
1082888273 11:58111211-58111233 CACCTCCTTTAGCCTAATGGAGG + Intronic
1083061644 11:59879132-59879154 CACCCTATTCACCCTACCTGTGG + Intergenic
1084423498 11:69072040-69072062 GACCCTCTTCTCCCTGAGGGTGG + Intronic
1084986033 11:72872901-72872923 AACCCTCATCACCCTACTGGTGG - Intronic
1100478606 12:94956585-94956607 TACTCTCTTCATCCTAATGTTGG + Intronic
1101315941 12:103628950-103628972 CACTCTCCTCACCCTAATCCTGG + Intronic
1101648861 12:106656576-106656598 CATCCTCTTCACCACAGTGGGGG + Intronic
1103065502 12:117894243-117894265 CACTCTCCTCATCCTAATGCTGG - Intronic
1106760640 13:32864194-32864216 CACCCTCTGCCCCCAAATTGTGG + Intergenic
1112703093 13:102034710-102034732 CACCCTCCTCACCCTAGTCCTGG + Intronic
1112857413 13:103788042-103788064 CACCCTCCTCACCCTTTTTGTGG + Intergenic
1113358136 13:109602553-109602575 CACGCTCTGCACCCCAAGGGTGG - Intergenic
1116728888 14:48596996-48597018 CTGCCTCTTCACTCTGATGGTGG + Intergenic
1117645993 14:57853532-57853554 CACACTCTTGACCCTATTGATGG - Intronic
1118717263 14:68569258-68569280 CACCCTCCTAACCCCTATGGGGG - Intronic
1120823889 14:88937757-88937779 CACCCACTTCGCTCTCATGGAGG + Intergenic
1128775245 15:70315532-70315554 CAACCAATTCACACTAATGGGGG + Intergenic
1128943112 15:71804558-71804580 CTCCCTCTTCACCCAAGAGGAGG - Intronic
1129331543 15:74830386-74830408 CACACTCTTAGCCCTCATGGGGG - Exonic
1130020422 15:80226112-80226134 TACCCACTTTACCCTGATGGTGG - Intergenic
1130938696 15:88490488-88490510 CAGCTTCTTGACCCCAATGGAGG - Intergenic
1131119164 15:89812521-89812543 CAGCCTCTTCAGCCCAATGCAGG + Intronic
1132847290 16:2006463-2006485 CCCCCTCCTCACCCTCAGGGAGG - Intronic
1142146397 16:88494611-88494633 CACCCTCTGCTCCCTACTGCAGG - Intronic
1143431505 17:6890826-6890848 CCCCTTCTTCTCCATAATGGAGG - Intronic
1143484694 17:7247235-7247257 CCCCTACTTCACCCTAAAGGAGG + Intronic
1143828921 17:9635478-9635500 GTTCCTCTTCACCCTAATGCAGG - Exonic
1144025316 17:11271927-11271949 CAGCCTCTTCACCCTCACGTAGG + Intronic
1144585594 17:16485820-16485842 CCCCCTCTGCATCCTGATGGAGG + Intronic
1147301444 17:39531278-39531300 CTCCCTCTTCCCCCTCTTGGTGG - Exonic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1149430757 17:56594250-56594272 CACCCTCTACGCCCTGGTGGTGG + Exonic
1149621757 17:58050587-58050609 TACCCTCTTCCCTCTAATCGTGG - Intergenic
1152516302 17:80826740-80826762 CACCCTGTGCACCCCACTGGAGG - Intronic
1156949417 18:42875784-42875806 CACCCTCTTCACCAGAAAGAAGG - Intronic
1160469376 18:79114787-79114809 CACACTATGCACACTAATGGGGG - Intronic
1161001090 19:1911534-1911556 CACCCGCTTCAACCTGGTGGTGG - Intronic
1162947859 19:14054586-14054608 CACTCTCTCCACCCAAATGAAGG + Exonic
1163355736 19:16809499-16809521 CACTCTCTTCACCCTAATCCTGG + Intronic
1166662939 19:44659006-44659028 CACCCTCATCAGTCAAATGGGGG - Intronic
1167568369 19:50271420-50271442 CACCCTCCTCAGCCTCAAGGTGG - Exonic
925732811 2:6933300-6933322 CTCCCTCTTCTCCATAATGAAGG - Intronic
925813070 2:7720282-7720304 CACCTTCTTCACGATCATGGTGG + Intergenic
929853044 2:45610706-45610728 CACCCTTTTCACGGTCATGGTGG - Intronic
930951051 2:57145180-57145202 CACCCCCGTCACCCTCATCGAGG + Intergenic
938745772 2:134276859-134276881 CACCAGCTTCACCCTAACGTGGG - Intronic
945431673 2:209772065-209772087 CTTCCTCTTCACCATAATGGTGG - Exonic
947447777 2:230177735-230177757 GAACCTCTTCATCCTAATTGTGG + Intronic
947715377 2:232336474-232336496 CACCATCTTCAGCCTGGTGGAGG + Exonic
947720886 2:232368580-232368602 CACCGTCTTCAGCCTGCTGGAGG + Intergenic
947734418 2:232447272-232447294 CACCATCTTCAGCCTGGTGGAGG + Intergenic
1170496180 20:16927708-16927730 CACCGTGTACACCCTAAAGGTGG - Intergenic
1172823228 20:37757611-37757633 CTCCCTCTTCACTCTCATGGAGG - Exonic
1172834462 20:37864058-37864080 CACCCTCTCCACCCAAGTGAGGG - Intronic
1174118289 20:48242884-48242906 CACCCTCTTCACCCAGGGGGTGG + Intergenic
1175038568 20:56023691-56023713 CACCCTCTTCACCCTCCAGTAGG - Intergenic
1182700767 22:32236012-32236034 CCCCCTCTTCATCCTAAAGATGG + Intronic
950553200 3:13680012-13680034 CAGCCTCTTCAGCCTCATGGAGG - Intergenic
953588901 3:44232549-44232571 AACCCTTTTCAACCTAATGCTGG + Intergenic
955733246 3:62009724-62009746 CACCCTCTCCACACTGATGCAGG + Intronic
957195567 3:77062718-77062740 CCCCCTCTTGACCCTCCTGGTGG - Intronic
964787010 3:160407802-160407824 CACCACCTTCACCCTAGTTGTGG - Intronic
966570838 3:181441470-181441492 CACCCACCTCACCCTAATCCAGG + Intergenic
969930454 4:10626009-10626031 CAGCCTCTACACCTTAAAGGTGG - Intronic
982076747 4:151744949-151744971 GACCCTTGTCACCCTAAAGGAGG - Intronic
984759107 4:183348563-183348585 CACCCTCCTTCCCCTCATGGGGG + Intergenic
985698880 5:1358678-1358700 CACCCTCTTCCCCCTCAGGTGGG - Intergenic
993045554 5:82862125-82862147 CACTTTCTTCACCCTAATTGGGG + Intergenic
994397926 5:99241567-99241589 CTCTCTCTTGACCCTACTGGGGG + Intergenic
1003335767 6:5170725-5170747 CACCCTTTTCTCCCCAATTGGGG + Intronic
1003977784 6:11360217-11360239 CACCCTCTTCACCCTAATGGGGG - Intronic
1004140002 6:13009718-13009740 CCCTCACATCACCCTAATGGTGG + Intronic
1006357370 6:33567892-33567914 CACCCTCCCCACCCTGCTGGGGG + Intergenic
1014194722 6:118541188-118541210 CATCCTCTTGATCCTAATGTTGG + Intronic
1020082858 7:5296046-5296068 CGGCCTCGTGACCCTAATGGCGG + Intronic
1022888935 7:34676080-34676102 CACCCTGTTCACCCTATTTTCGG - Intronic
1025211412 7:57021141-57021163 CAGCCTCGTGACCCTAATCGCGG - Intergenic
1025660541 7:63555706-63555728 CAGCCTCGTGACCCTAATCGCGG + Intergenic
1035393462 7:158520854-158520876 CAGCCTCTTCACTCTCATGAGGG + Intronic
1038433375 8:27517650-27517672 CACTCTCTTCAAACAAATGGTGG + Intronic
1039456709 8:37712062-37712084 GAGGCTCTTCACCCTAATAGTGG - Intergenic
1039508294 8:38068298-38068320 CAGCCTCTTCACTCCAATGAGGG + Intergenic
1040386939 8:46920356-46920378 CACCCTCTTCAGCCTGCAGGAGG - Intergenic
1041586135 8:59522076-59522098 CCCCCTCTCCACCCTCAAGGAGG - Intergenic
1043841752 8:85113495-85113517 TACCCTTTTCACACAAATGGTGG - Intronic
1046977035 8:120291118-120291140 CACCATCTTCTGCTTAATGGAGG + Intronic
1048126820 8:131645068-131645090 CCCACCCTTCACCCTAATGTAGG - Intergenic
1050858001 9:10386523-10386545 AACCAACTTCACGCTAATGGAGG + Intronic
1053573263 9:39331800-39331822 GGCCCTCTTCACCCTACTGCTGG - Intergenic
1053624620 9:39856032-39856054 GGCCCTCTTCACCCTACTGCTGG - Intergenic
1053880250 9:42587196-42587218 GGCCCTCTTCACCCTACTGCTGG + Intergenic
1053892415 9:42707130-42707152 GGCCCTCTTCACCCTACTGCTGG - Intergenic
1054094833 9:60890506-60890528 GGCCCTCTTCACCCTACTGCTGG - Intergenic
1054116300 9:61166410-61166432 GGCCCTCTTCACCCTACTGCTGG - Intergenic
1054123881 9:61287211-61287233 GGCCCTCTTCACCCTACTGCTGG + Intergenic
1054219276 9:62394666-62394688 GGCCCTCTTCACCCTACTGCTGG + Intergenic
1054231438 9:62514507-62514529 GGCCCTCTTCACCCTACTGCTGG - Intergenic
1054591459 9:67016134-67016156 GGCCCTCTTCACCCTACTGCTGG + Intergenic
1055303858 9:74908837-74908859 AATCCACTTCACCCTATTGGTGG - Intergenic
1056062151 9:82894660-82894682 CACTCTCTTCATCCTATTTGTGG - Intergenic
1056650726 9:88459031-88459053 CAGCATCTTCACCCATATGGTGG - Intronic
1057308827 9:93928606-93928628 CACCCTCTGCACCCTAAATCTGG - Intergenic
1057725009 9:97562286-97562308 CATCATCTCCATCCTAATGGAGG - Intronic
1187674532 X:21702452-21702474 TACCCTCCTCACTCTGATGGAGG - Intergenic
1188755990 X:33964340-33964362 CCCACTCTTCACCCTCATGTAGG + Intergenic
1194087904 X:89551918-89551940 CACCCTCTAGACCCTGAAGGTGG - Intergenic