ID: 1003981518

View in Genome Browser
Species Human (GRCh38)
Location 6:11394749-11394771
Sequence GCTTTGTTGTTGACTGGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981518_1003981521 -2 Left 1003981518 6:11394749-11394771 CCTAAGCCAGTCAACAACAAAGC No data
Right 1003981521 6:11394770-11394792 GCAAATGAAATGGTCCTAAATGG No data
1003981518_1003981525 27 Left 1003981518 6:11394749-11394771 CCTAAGCCAGTCAACAACAAAGC No data
Right 1003981525 6:11394799-11394821 ACCGTCACATTTTACCTCCTGGG No data
1003981518_1003981522 4 Left 1003981518 6:11394749-11394771 CCTAAGCCAGTCAACAACAAAGC No data
Right 1003981522 6:11394776-11394798 GAAATGGTCCTAAATGGTTTAGG No data
1003981518_1003981524 26 Left 1003981518 6:11394749-11394771 CCTAAGCCAGTCAACAACAAAGC No data
Right 1003981524 6:11394798-11394820 GACCGTCACATTTTACCTCCTGG No data
1003981518_1003981527 28 Left 1003981518 6:11394749-11394771 CCTAAGCCAGTCAACAACAAAGC No data
Right 1003981527 6:11394800-11394822 CCGTCACATTTTACCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981518 Original CRISPR GCTTTGTTGTTGACTGGCTT AGG (reversed) Intergenic