ID: 1003981523

View in Genome Browser
Species Human (GRCh38)
Location 6:11394784-11394806
Sequence GTGACGGTCCTAAACCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981523_1003981525 -8 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981525 6:11394799-11394821 ACCGTCACATTTTACCTCCTGGG No data
1003981523_1003981531 27 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data
1003981523_1003981527 -7 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981527 6:11394800-11394822 CCGTCACATTTTACCTCCTGGGG No data
1003981523_1003981524 -9 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981524 6:11394798-11394820 GACCGTCACATTTTACCTCCTGG No data
1003981523_1003981528 4 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981528 6:11394811-11394833 TACCTCCTGGGGTTAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981523 Original CRISPR GTGACGGTCCTAAACCATTT AGG (reversed) Intergenic