ID: 1003981525

View in Genome Browser
Species Human (GRCh38)
Location 6:11394799-11394821
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981519_1003981525 21 Left 1003981519 6:11394755-11394777 CCAGTCAACAACAAAGCAAATGA No data
Right 1003981525 6:11394799-11394821 ACCGTCACATTTTACCTCCTGGG No data
1003981518_1003981525 27 Left 1003981518 6:11394749-11394771 CCTAAGCCAGTCAACAACAAAGC 0: 1
1: 0
2: 0
3: 16
4: 222
Right 1003981525 6:11394799-11394821 ACCGTCACATTTTACCTCCTGGG No data
1003981523_1003981525 -8 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981525 6:11394799-11394821 ACCGTCACATTTTACCTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981525 Original CRISPR ACCGTCACATTTTACCTCCT GGG Intergenic