ID: 1003981526

View in Genome Browser
Species Human (GRCh38)
Location 6:11394800-11394822
Sequence CCCCAGGAGGTAAAATGTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981526_1003981531 11 Left 1003981526 6:11394800-11394822 CCGTCACATTTTACCTCCTGGGG No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981526 Original CRISPR CCCCAGGAGGTAAAATGTGA CGG (reversed) Intergenic