ID: 1003981528

View in Genome Browser
Species Human (GRCh38)
Location 6:11394811-11394833
Sequence TACCTCCTGGGGTTAAGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981523_1003981528 4 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981528 6:11394811-11394833 TACCTCCTGGGGTTAAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981528 Original CRISPR TACCTCCTGGGGTTAAGAAA AGG Intergenic
No off target data available for this crispr