ID: 1003981528 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 6:11394811-11394833 |
| Sequence | TACCTCCTGGGGTTAAGAAA AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1003981523_1003981528 | 4 | Left | 1003981523 | 6:11394784-11394806 | CCTAAATGGTTTAGGACCGTCAC | No data | ||
| Right | 1003981528 | 6:11394811-11394833 | TACCTCCTGGGGTTAAGAAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1003981528 | Original CRISPR | TACCTCCTGGGGTTAAGAAA AGG | Intergenic | ||