ID: 1003981529

View in Genome Browser
Species Human (GRCh38)
Location 6:11394813-11394835
Sequence AGCCTTTTCTTAACCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981529_1003981535 28 Left 1003981529 6:11394813-11394835 CCTCCTGGGGTTAAGAAAAGGCT No data
Right 1003981535 6:11394864-11394886 TCATGTCCTTTGCAGGGACATGG No data
1003981529_1003981533 21 Left 1003981529 6:11394813-11394835 CCTCCTGGGGTTAAGAAAAGGCT No data
Right 1003981533 6:11394857-11394879 AATGAGTTCATGTCCTTTGCAGG No data
1003981529_1003981534 22 Left 1003981529 6:11394813-11394835 CCTCCTGGGGTTAAGAAAAGGCT No data
Right 1003981534 6:11394858-11394880 ATGAGTTCATGTCCTTTGCAGGG No data
1003981529_1003981531 -2 Left 1003981529 6:11394813-11394835 CCTCCTGGGGTTAAGAAAAGGCT No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981529 Original CRISPR AGCCTTTTCTTAACCCCAGG AGG (reversed) Intergenic