ID: 1003981530

View in Genome Browser
Species Human (GRCh38)
Location 6:11394816-11394838
Sequence CTGAGCCTTTTCTTAACCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981530_1003981535 25 Left 1003981530 6:11394816-11394838 CCTGGGGTTAAGAAAAGGCTCAG No data
Right 1003981535 6:11394864-11394886 TCATGTCCTTTGCAGGGACATGG No data
1003981530_1003981534 19 Left 1003981530 6:11394816-11394838 CCTGGGGTTAAGAAAAGGCTCAG No data
Right 1003981534 6:11394858-11394880 ATGAGTTCATGTCCTTTGCAGGG No data
1003981530_1003981531 -5 Left 1003981530 6:11394816-11394838 CCTGGGGTTAAGAAAAGGCTCAG No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data
1003981530_1003981533 18 Left 1003981530 6:11394816-11394838 CCTGGGGTTAAGAAAAGGCTCAG No data
Right 1003981533 6:11394857-11394879 AATGAGTTCATGTCCTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981530 Original CRISPR CTGAGCCTTTTCTTAACCCC AGG (reversed) Intergenic