ID: 1003981531

View in Genome Browser
Species Human (GRCh38)
Location 6:11394834-11394856
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981530_1003981531 -5 Left 1003981530 6:11394816-11394838 CCTGGGGTTAAGAAAAGGCTCAG No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data
1003981526_1003981531 11 Left 1003981526 6:11394800-11394822 CCGTCACATTTTACCTCCTGGGG No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data
1003981529_1003981531 -2 Left 1003981529 6:11394813-11394835 CCTCCTGGGGTTAAGAAAAGGCT No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data
1003981523_1003981531 27 Left 1003981523 6:11394784-11394806 CCTAAATGGTTTAGGACCGTCAC No data
Right 1003981531 6:11394834-11394856 CTCAGTCTGCAGCCATAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981531 Original CRISPR CTCAGTCTGCAGCCATAAAA AGG Intergenic