ID: 1003981535

View in Genome Browser
Species Human (GRCh38)
Location 6:11394864-11394886
Sequence TCATGTCCTTTGCAGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003981529_1003981535 28 Left 1003981529 6:11394813-11394835 CCTCCTGGGGTTAAGAAAAGGCT No data
Right 1003981535 6:11394864-11394886 TCATGTCCTTTGCAGGGACATGG No data
1003981532_1003981535 -5 Left 1003981532 6:11394846-11394868 CCATAAAAAGGAATGAGTTCATG No data
Right 1003981535 6:11394864-11394886 TCATGTCCTTTGCAGGGACATGG No data
1003981530_1003981535 25 Left 1003981530 6:11394816-11394838 CCTGGGGTTAAGAAAAGGCTCAG No data
Right 1003981535 6:11394864-11394886 TCATGTCCTTTGCAGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003981535 Original CRISPR TCATGTCCTTTGCAGGGACA TGG Intergenic