ID: 1003985178

View in Genome Browser
Species Human (GRCh38)
Location 6:11428048-11428070
Sequence CGGACTGAGCACAGGGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003985178_1003985184 0 Left 1003985178 6:11428048-11428070 CCCGGGTCCCTGTGCTCAGTCCG No data
Right 1003985184 6:11428071-11428093 GCTCTCTCTGTAGTTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003985178 Original CRISPR CGGACTGAGCACAGGGACCC GGG (reversed) Intergenic
No off target data available for this crispr