ID: 1003985613

View in Genome Browser
Species Human (GRCh38)
Location 6:11431709-11431731
Sequence GTGTGTGTCAGTGAAGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003985610_1003985613 30 Left 1003985610 6:11431656-11431678 CCAAGAGTAGAATCTTGAGCAGC No data
Right 1003985613 6:11431709-11431731 GTGTGTGTCAGTGAAGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003985613 Original CRISPR GTGTGTGTCAGTGAAGCCCT TGG Intergenic