ID: 1003989975

View in Genome Browser
Species Human (GRCh38)
Location 6:11476597-11476619
Sequence CAGTGTGACAGCAGTGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003989973_1003989975 5 Left 1003989973 6:11476569-11476591 CCAAGGAAGTGATGGCAGTGGTT No data
Right 1003989975 6:11476597-11476619 CAGTGTGACAGCAGTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003989975 Original CRISPR CAGTGTGACAGCAGTGGAGA TGG Intergenic
No off target data available for this crispr