ID: 1003991094

View in Genome Browser
Species Human (GRCh38)
Location 6:11487305-11487327
Sequence AAGCTATTCTGTAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003991089_1003991094 29 Left 1003991089 6:11487253-11487275 CCTGGGTGTCAGAGCAAGACTCT 0: 48
1: 9393
2: 41887
3: 96377
4: 153887
Right 1003991094 6:11487305-11487327 AAGCTATTCTGTAGGGCAGAGGG 0: 1
1: 0
2: 0
3: 9
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003991094 Original CRISPR AAGCTATTCTGTAGGGCAGA GGG Intergenic
902454585 1:16523342-16523364 AAGCTTCTCTGCAGGTCAGAGGG + Intergenic
902497872 1:16887011-16887033 AAGCTTCTCTGCAGGTCAGAGGG - Intronic
908162644 1:61426110-61426132 ATCCTATTCTTTAGAGCAGAGGG - Intronic
910826384 1:91412085-91412107 AAGTTATTTTGTAGGCCATAAGG + Intergenic
911757048 1:101570852-101570874 AGACTAGTCTGTAGGGCTGAAGG - Intergenic
914517039 1:148382966-148382988 AAGCTTTTCTGCAGGTCACAGGG + Intergenic
915744845 1:158147919-158147941 TACCTTTTCTGCAGGGCAGATGG + Intergenic
916493207 1:165320455-165320477 AGGATATTCTGCAAGGCAGAAGG + Intronic
916539678 1:165740711-165740733 AATCTATTCATGAGGGCAGAGGG - Intronic
918346317 1:183610337-183610359 TGGCTATTCTGTAGGACAAATGG + Intergenic
919524019 1:198624812-198624834 AGGAAATTCTGGAGGGCAGAGGG + Intergenic
920007354 1:202843217-202843239 AAGCTTTTAGGTAGGTCAGAGGG - Intergenic
920826348 1:209427218-209427240 ATGCTATTCTGGAAGGAAGAGGG + Intergenic
922011744 1:221595814-221595836 AAGCTTCTCTGAAAGGCAGATGG - Intergenic
922747923 1:228057229-228057251 AAGCTAGTTTTTAGGGCAGGAGG + Intronic
923016172 1:230128177-230128199 AGGCTATGCTATAGGACAGATGG - Intronic
1065307397 10:24381962-24381984 CAGCTTTTCTGAAAGGCAGAAGG + Intronic
1070284983 10:75076314-75076336 AAGGGATTGTGTGGGGCAGAGGG + Intergenic
1070430332 10:76331391-76331413 AAAATATTCTGGAAGGCAGAAGG - Intronic
1071736180 10:88303445-88303467 AAGCTATAGTGTAGGGCCGCAGG - Intronic
1073867810 10:107825150-107825172 AAACTATTCTGTATGACAGTGGG + Intergenic
1074155155 10:110791958-110791980 AAGACATACTGTAGGGGAGAAGG - Intronic
1074478781 10:113798826-113798848 GAGATATTCTGTAGGTCTGAGGG - Intergenic
1075725595 10:124609209-124609231 TTGCTATTGTGTAGGCCAGAGGG - Intronic
1077911618 11:6576965-6576987 AAGCTGTTCTGTAGCACGGATGG + Intronic
1078348581 11:10573657-10573679 AGGCTTTTCTGTGGGGCAGCTGG + Exonic
1078477638 11:11645316-11645338 AATCTATTCTCAAGGGCATAGGG + Intergenic
1079459128 11:20664444-20664466 AACTTATTCTTTAGAGCAGAGGG + Intergenic
1080110932 11:28566992-28567014 AAGCAATCCTGTCAGGCAGAAGG - Intergenic
1081296050 11:41390796-41390818 AAGCTATGGTGTAGTGGAGAGGG - Intronic
1083395643 11:62389882-62389904 AAGCTGCTCTTTAGGGCAGATGG - Intronic
1085061011 11:73447162-73447184 AATCTAGTCTGAAGGGGAGAAGG - Intronic
1086420574 11:86633676-86633698 ATGCTGTTCTATAGGCCAGAGGG + Intronic
1087605191 11:100368767-100368789 ACGGTATTCTGTAGAGCAAAAGG + Intergenic
1088141730 11:106624800-106624822 AAGCTATAGTGTAGCACAGATGG + Intergenic
1088234402 11:107707153-107707175 AAACTAGTCTGAAGGGCAGAGGG - Intergenic
1090188454 11:124752933-124752955 AAGCTACTCTGAACAGCAGAGGG - Intronic
1091038170 11:132252465-132252487 GAGCAATTCTGTGGGGCATATGG + Intronic
1091310222 11:134569102-134569124 ACTCTCTTCTGTTGGGCAGAAGG + Intergenic
1092085103 12:5750589-5750611 AAGCTCTTCTCCAGGGCAGGGGG - Intronic
1093555999 12:20474865-20474887 AAGTTATTTTATAGGGCAAAAGG - Intronic
1094462272 12:30709295-30709317 AAGCTATTCTGTTTTGCAGTAGG - Intergenic
1097035774 12:56122519-56122541 TAGCTATTCTGTGTGGAAGATGG + Exonic
1100815249 12:98380776-98380798 ATTCCTTTCTGTAGGGCAGATGG - Intergenic
1102201395 12:111060109-111060131 AAGCTTTTCAGTTGGGGAGAGGG - Intronic
1104546380 12:129716629-129716651 AAGTTATCCTGTATGGCAAAGGG + Intronic
1107456241 13:40557608-40557630 AATCTAATCTGCAGGGCAGAAGG + Exonic
1109073430 13:57800740-57800762 AAGCTTTTCTGCATGGCTGAAGG - Intergenic
1111141943 13:84130217-84130239 AAGCTTTCCTGAAGGGCAGATGG - Intergenic
1111342672 13:86908691-86908713 CAGTTATTCTGTAGGACAGTAGG + Intergenic
1113416794 13:110134889-110134911 AAGCTATTTTGTAGCGACGAAGG + Intergenic
1115061092 14:29190990-29191012 AAGCCATTAGGTAGGGCTGAAGG - Intergenic
1117305055 14:54465840-54465862 CAGCCAATCTCTAGGGCAGAGGG - Intergenic
1117434443 14:55702713-55702735 AAGCTATTCTGGGGCGCAGTAGG + Intergenic
1118892439 14:69921450-69921472 AAGTTTTTCAGCAGGGCAGAAGG + Intronic
1121329537 14:93041257-93041279 AAGGTACTTTGTAGGACAGAGGG - Intronic
1122283012 14:100635368-100635390 TAGCTCCTCTGTAGGGCAGCAGG + Intergenic
1122430929 14:101642883-101642905 AAGAAATTCTGAAGGGCAGTGGG + Intergenic
1122792115 14:104188393-104188415 AAGCTAATCTGCCTGGCAGAGGG + Intergenic
1123850557 15:24351699-24351721 AAACTATTCTGTAAGCCACAAGG + Intergenic
1123855436 15:24405946-24405968 AAACTATTCTGTAAGCCACAAGG + Intergenic
1123871395 15:24577959-24577981 AAACTATTCTGTAAGCCACAAGG + Intergenic
1125848243 15:42878788-42878810 AGGCTATTTTGTTGGGAAGAAGG + Intronic
1126793674 15:52243168-52243190 ATGCTATTCTGTAGGAAACACGG + Intronic
1129565931 15:76623744-76623766 AAGCTATTCTGAAATGCATATGG - Intronic
1130213418 15:81946667-81946689 CACCTTTTCTGCAGGGCAGATGG + Intergenic
1134236974 16:12474218-12474240 AAGTTAATCTGCAAGGCAGATGG - Intronic
1134380907 16:13725048-13725070 AAGCTAAGCTGTAGGGTACATGG + Intergenic
1135258216 16:20958751-20958773 AAGCTCTTCAGTATAGCAGAAGG - Intronic
1137310182 16:47248096-47248118 AAGCAATTGTGTAAAGCAGAAGG + Intronic
1137684543 16:50377089-50377111 AAGCTTTTATTTTGGGCAGAGGG + Intergenic
1139160065 16:64494111-64494133 AAGCTTTTCCTTATGGCAGAAGG - Intergenic
1139538854 16:67598718-67598740 AAGCAATTCTGTAGGGGATAAGG + Intronic
1140608052 16:76564561-76564583 AATCTATGCTGGGGGGCAGAGGG - Intronic
1140847392 16:78903518-78903540 TACCTTTTCTGCAGGGCAGATGG - Intronic
1142539934 17:650666-650688 AAGCTTTGCTGGAGGGCAAATGG + Intronic
1143163536 17:4886297-4886319 AAGAGATTCTGGGGGGCAGAGGG + Intronic
1149203782 17:54219364-54219386 AAGCTGTTATCTAGAGCAGAAGG - Intergenic
1151347916 17:73514617-73514639 AGCTTATTCTGGAGGGCAGATGG - Intronic
1156201546 18:34838150-34838172 CAGCTTTTCTGAAGGGCAAAGGG + Intronic
1157175010 18:45443649-45443671 GTGATCTTCTGTAGGGCAGAGGG + Intronic
1164858459 19:31543640-31543662 CAGCAATTCTCTGGGGCAGAGGG + Intergenic
1166345107 19:42160703-42160725 AAGCTTTTGTGTTTGGCAGAGGG + Intronic
1166952951 19:46442355-46442377 AACCTTTTCTGTGGGGCAGATGG + Intergenic
925752252 2:7099240-7099262 AGGCTCTCCTGTAGGCCAGATGG + Intergenic
926238911 2:11069945-11069967 AAGCAAGTTTTTAGGGCAGATGG - Intergenic
928117003 2:28552625-28552647 GAGCAAGTCTGTGGGGCAGACGG + Intronic
928707749 2:33968986-33969008 ATGATATTCAGTAGAGCAGATGG - Intergenic
930210579 2:48633222-48633244 AAGATAGTCAGTAGGACAGAGGG - Intronic
932214251 2:69956267-69956289 AAGCTCTTCTGTAGAGTTGAGGG + Intergenic
934030450 2:88040908-88040930 AGGGTATTCTGGAGGACAGAAGG + Intronic
937962080 2:127467811-127467833 AAGCTATCCTGGAAGGAAGAAGG + Intronic
938932084 2:136095359-136095381 AGGCTACTCTGCAGAGCAGAGGG + Intergenic
939450662 2:142369699-142369721 AAGCTATATTATAGAGCAGATGG - Intergenic
942326853 2:174782997-174783019 AATGCATTCTGTAGGGGAGAAGG + Intergenic
945514918 2:210751341-210751363 CAGATATTCTGCAGAGCAGAAGG + Intergenic
946879158 2:224160176-224160198 AAGCTATTTGGTAGGGGGGACGG + Intergenic
947932510 2:233975384-233975406 AGGGTGTTCTCTAGGGCAGAGGG + Intronic
948259956 2:236596366-236596388 ACGCCATTATGTAGGACAGAGGG + Intergenic
948486819 2:238286644-238286666 AAACTACTCTGTTTGGCAGAGGG - Intronic
1171016479 20:21546593-21546615 AAGCTACTCTGTAAGGAAGTGGG - Intergenic
1174387276 20:50194562-50194584 AAGCGAAGCTGTGGGGCAGACGG - Intergenic
1174728511 20:52890400-52890422 AAGCTTTTATTTTGGGCAGACGG - Intergenic
1178047263 21:28709611-28709633 AATCTTTTTTATAGGGCAGAAGG - Intergenic
1183622688 22:38983737-38983759 AAGCTATTTTTTAGGGGTGAAGG + Intronic
1183783173 22:40011942-40011964 CAGCTATTCTGTAGAGCAACAGG - Intronic
1184725968 22:46346644-46346666 AAGCTACTCTGGAGCACAGAGGG - Intronic
1185202681 22:49517663-49517685 AGGGTCTTCTGTAGGGCAGTGGG - Intronic
949577727 3:5355041-5355063 AAGCTATTCTGGTGTGGAGATGG + Intergenic
950933898 3:16819241-16819263 AAGCTTTTGTGTTGAGCAGAAGG - Intronic
952096746 3:29963001-29963023 AAGCAATTGTGAAGGGCACAGGG - Intronic
955151778 3:56374705-56374727 AAGCGCTTCTGTGGGACAGAAGG + Intronic
955811914 3:62799923-62799945 GAGCTTCTCTGCAGGGCAGAGGG + Intronic
956645971 3:71456562-71456584 AAGCTAGTGTGTAGGGGAGTTGG - Intronic
957259494 3:77881578-77881600 AATCTATTTAGGAGGGCAGAGGG - Intergenic
957772509 3:84712579-84712601 AAGAGATTCTGTATGGCAAAAGG + Intergenic
961919825 3:130414171-130414193 AAGTTATTCTGATGGGAAGAAGG + Intronic
962490662 3:135890907-135890929 AAGCTATACTGAAGGGAAGTAGG - Intergenic
963094284 3:141519157-141519179 ATGATACTCTGTGGGGCAGAGGG - Intronic
963166074 3:142205129-142205151 CAGCTCTTCTGTAGGTCAGGAGG - Intronic
963822084 3:149908697-149908719 AAGCTGATCTATAGGACAGAAGG + Intronic
969095951 4:4732955-4732977 TAGCTATTCTGTAGCTCTGAGGG + Intergenic
969845513 4:9917218-9917240 AGCCTATTGTGTAAGGCAGAGGG + Intronic
970778645 4:19708600-19708622 AAGGTATTTTGTAGTGCAGTTGG + Intergenic
971078107 4:23173979-23174001 AAGCTATACTGTAATGCTGATGG - Intergenic
973045076 4:45526482-45526504 AAGCAATTCTGGAGTGAAGATGG - Intergenic
973638227 4:52879247-52879269 AAGGTATTCTGGTGGGTAGATGG - Intronic
981746069 4:148053489-148053511 AAGCTCTGCTGTGGGGGAGAAGG - Intronic
987458675 5:18178976-18178998 AAGCTATTCTGGAGAGCAAAGGG - Intergenic
988054391 5:26074603-26074625 AAGCCATTCTGTAGGGAATTGGG - Intergenic
989712118 5:44411685-44411707 CAGCTATCCTCTAGGGCAGGAGG + Intergenic
990040565 5:51374155-51374177 AATCTATTCTGGAGGTCACAAGG - Intergenic
991974511 5:72172952-72172974 AAGCTATTCTAAAGGGAAGCAGG - Intronic
995085353 5:108102588-108102610 AGGCTACTCTGTTGGTCAGAAGG + Intronic
996000577 5:118357383-118357405 AAGCTGTCCTGTAGATCAGAAGG - Intergenic
998039831 5:138945046-138945068 CAGCGATTCTGTAAAGCAGAGGG - Intergenic
999609838 5:153357259-153357281 ATGCTATTCTGTGTGGTAGATGG + Intergenic
1000808413 5:165827442-165827464 GAGCTATTGTGTAGGGAAGCTGG + Intergenic
1001205387 5:169757430-169757452 TAGGTATTCTGTAGGGGAAAAGG - Intronic
1003991094 6:11487305-11487327 AAGCTATTCTGTAGGGCAGAGGG + Intergenic
1004402944 6:15305473-15305495 AAGCTATGTTGTAGGGCAAGAGG - Intronic
1004965674 6:20848204-20848226 CATCTTTTCTGCAGGGCAGATGG - Intronic
1009036009 6:58117800-58117822 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1009211827 6:60871401-60871423 CACCTTTTCTGCAGGGCAGATGG - Intergenic
1010870916 6:81037373-81037395 GAACTATTCTGTGGGGAAGAAGG + Intergenic
1014210016 6:118698924-118698946 ACTCTATTCTATAGGTCAGAGGG + Intronic
1015047532 6:128794218-128794240 CAGCTATTCGGGAGGGCTGAGGG + Intergenic
1015248521 6:131102576-131102598 AAGCTGTTCTGTAGTTCTGAGGG - Intergenic
1015423471 6:133037956-133037978 TAGCTAGGCTGAAGGGCAGAGGG - Intergenic
1015445273 6:133296636-133296658 AAGCTTTTCGGGAGGGAAGATGG + Intronic
1018277221 6:162145993-162146015 AACCTTTTCTGTGTGGCAGATGG - Intronic
1021364334 7:19757587-19757609 AGACTATTCTGTAGGTCTGAGGG + Intronic
1024693247 7:51825939-51825961 AAGCCATTCTGTGGGGGAGAAGG - Intergenic
1024978710 7:55137772-55137794 AAGCTATTCTGTAGTGAAAATGG + Intronic
1028186859 7:87796614-87796636 AAGAAATTCTGGAGGCCAGAAGG + Intronic
1028743874 7:94306274-94306296 AAGCTATTCCAGAGGGCACAGGG - Intergenic
1030546308 7:110900551-110900573 AAAATGTTCAGTAGGGCAGAAGG - Intronic
1033245172 7:139711910-139711932 ACACTATTCTGAAGGACAGAGGG - Intronic
1033982986 7:147188665-147188687 AAGATATTCTGAAGTGGAGAAGG + Intronic
1038412518 8:27369215-27369237 AAGGTAAGCTGTAGGGCAGGGGG - Intronic
1041610388 8:59839731-59839753 TATCTATTCTTGAGGGCAGATGG + Intergenic
1042320354 8:67468971-67468993 AGACTAAACTGTAGGGCAGAAGG - Intronic
1046605177 8:116363697-116363719 AGTCTATTCTGTAGGTTAGAGGG - Intergenic
1046624870 8:116565686-116565708 AATCTATTTTGTAGTGCAGTAGG - Intergenic
1046773242 8:118137364-118137386 AAGTTTTTCTGGAAGGCAGATGG - Intergenic
1047390778 8:124449263-124449285 CTGCTTTTCTGCAGGGCAGAAGG - Intergenic
1051190766 9:14509655-14509677 AAGTTATTCTGTCTGTCAGAAGG + Intergenic
1052773360 9:32709507-32709529 AAGCTATTTCTTAGGGGAGAGGG + Intergenic
1055181929 9:73399247-73399269 AAACTATTCTGTAGGATAAATGG - Intergenic
1055570362 9:77610236-77610258 TAACTATTCTATAGGGGAGAGGG - Intronic
1057924360 9:99130377-99130399 AAGCACTGCTGTAGCGCAGAAGG + Intronic
1189069537 X:37848990-37849012 CACCTTTTCTGCAGGGCAGATGG - Intronic
1189181004 X:39004425-39004447 AGGCTAGCCAGTAGGGCAGAAGG + Intergenic
1191269097 X:58439231-58439253 GAGATATTTTGTAGGGCAAAGGG - Intergenic
1192565503 X:72159944-72159966 AAGATAGTCAGTAGGACAGAAGG + Intergenic
1193577856 X:83225707-83225729 CAGCTATTGTGGAAGGCAGATGG - Intergenic
1196106014 X:111896205-111896227 AAGCTTGGCTGTAAGGCAGAAGG - Intronic
1198798130 X:140421363-140421385 AATCTATTCATGAGGGCAGAGGG + Intergenic
1199001593 X:142644624-142644646 ATGATATTCAGTAGGTCAGAGGG - Intergenic
1199360457 X:146911866-146911888 AAGCTATCCTGCAGGGAGGAAGG - Intergenic
1199365954 X:146983216-146983238 ATGTTTTTCTGTAGGGCATAAGG + Intergenic