ID: 1003992097

View in Genome Browser
Species Human (GRCh38)
Location 6:11496410-11496432
Sequence TTGACAGCCCTCATACATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003992097_1003992100 3 Left 1003992097 6:11496410-11496432 CCTCCATGTATGAGGGCTGTCAA No data
Right 1003992100 6:11496436-11496458 ACAGTGTGCCCTCTTGCGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003992097 Original CRISPR TTGACAGCCCTCATACATGG AGG (reversed) Intergenic
No off target data available for this crispr