ID: 1003992812

View in Genome Browser
Species Human (GRCh38)
Location 6:11503652-11503674
Sequence CTCATTTACCAGGTAAGTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003992810_1003992812 -2 Left 1003992810 6:11503631-11503653 CCACGTTCATGGTCATGGAATCT 0: 1
1: 0
2: 1
3: 16
4: 113
Right 1003992812 6:11503652-11503674 CTCATTTACCAGGTAAGTATTGG 0: 1
1: 0
2: 1
3: 10
4: 149
1003992807_1003992812 14 Left 1003992807 6:11503615-11503637 CCTTGCACTGGGTAAACCACGTT 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1003992812 6:11503652-11503674 CTCATTTACCAGGTAAGTATTGG 0: 1
1: 0
2: 1
3: 10
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003992812 Original CRISPR CTCATTTACCAGGTAAGTAT TGG Intergenic
901384223 1:8896602-8896624 GTCATTTGCCAGGGAAGGATTGG - Intergenic
904363326 1:29992768-29992790 CTCATGTAACTGGAAAGTATGGG + Intergenic
909756122 1:79228040-79228062 CTTATTTCCCACGTAATTATTGG - Intergenic
910752077 1:90642368-90642390 ATCATTTATCAGGAAACTATTGG + Intergenic
911336464 1:96586516-96586538 CTCATTTACCAGGCATGTTTGGG + Intergenic
913473052 1:119209379-119209401 CTAATTTATCAGATAACTATTGG - Intergenic
913533342 1:119748743-119748765 TTCATTTACCAGCTAAGAGTGGG + Exonic
918154272 1:181830612-181830634 GTCATTTGCCAGGGAAGGATTGG - Intergenic
919646538 1:200100421-200100443 CTCACTAACCAGGTAACTTTGGG - Intronic
921444759 1:215232532-215232554 TTCATTTAACAGGTACTTATTGG + Intronic
922437779 1:225623347-225623369 CTCAGTCACCAGGTTAGTACTGG - Intronic
923303446 1:232664765-232664787 CTTATTTAACAGGTAATTTTAGG - Intergenic
923320926 1:232832168-232832190 CTCCCCTCCCAGGTAAGTATAGG + Intergenic
924227026 1:241930528-241930550 CTCATTCATCAGATATGTATTGG + Intergenic
924565672 1:245196172-245196194 CTCATTTACCAGGAAAATAGTGG - Intronic
1065357208 10:24853817-24853839 TGCATTTACCAGCTAAGGATAGG - Intronic
1066613909 10:37277562-37277584 GTCATTTGCCAGGGAAGGATTGG + Intronic
1067900316 10:50233413-50233435 CTCATTTATCAGCTAAGGAAAGG + Intronic
1068500993 10:57839850-57839872 GTCATTTACCAGGGAAGGATTGG - Intergenic
1070146846 10:73780628-73780650 CTCATTTAACAAGTATTTATTGG + Intergenic
1072370975 10:94766206-94766228 GTCATTTGCCAGGGAAGGATTGG + Intronic
1074107719 10:110401077-110401099 CTCATGTACCATGTAAGAACAGG + Intergenic
1075693244 10:124415201-124415223 TTCATTTACCTGTTAAGTTTAGG + Intronic
1078736939 11:14029053-14029075 CTCATCTTCCAGGTGAGAATTGG - Intronic
1078763741 11:14273643-14273665 CCCACTTAACAGGTAAGTAGGGG - Intergenic
1081878887 11:46430880-46430902 CTCTTTGCACAGGTAAGTATAGG - Intronic
1090098593 11:123769538-123769560 CCCAATTACCAGGTGAGTCTAGG + Intergenic
1090466381 11:126938131-126938153 CTACTTTGCCAGGTAGGTATAGG - Intronic
1093345939 12:18038361-18038383 GTCATTTGCCAGGGAAGGATTGG - Intergenic
1094249948 12:28348228-28348250 CTCATTTGCCAGCTATGTTTAGG + Intronic
1095273196 12:40246403-40246425 CACATATACCAGGTGAGTTTTGG + Intronic
1096104021 12:48986362-48986384 CTCATTTACAGGGGAAGTAGTGG - Intergenic
1096908168 12:54955511-54955533 TCCAATTACCAGGTAAGTCTAGG + Intronic
1097611532 12:61828060-61828082 TTTATTTACCAGGTTAGTAATGG + Intronic
1098489270 12:71056239-71056261 CTCAGTTACCATGTATGTTTAGG - Intronic
1098771251 12:74556313-74556335 CTCATTTACCTGGCATGTATAGG + Intergenic
1100904658 12:99284112-99284134 CTACTTTACTAGGTAAGTTTCGG - Intronic
1103901685 12:124306777-124306799 CTCATTGTCCAGGCAGGTATGGG + Intronic
1104347841 12:128018716-128018738 TTCAGTCACCAGGTAAATATAGG - Intergenic
1106433411 13:29703677-29703699 CTCATTGACCAGGGAAGGAGTGG + Intergenic
1108103822 13:46987473-46987495 CTCATTTCCAGGCTAAGTATTGG - Intergenic
1113032086 13:106005041-106005063 TTCATTTACAAGGTAGGTCTAGG - Intergenic
1113142135 13:107165748-107165770 CTAATATAGCAGGTAGGTATTGG - Exonic
1113178983 13:107603243-107603265 CTCATTTTCCAGGTGACTTTTGG + Intronic
1113193585 13:107778776-107778798 CTCATTCATCAGGTCAGTAAGGG + Intronic
1114376408 14:22151369-22151391 CTCAATTACCAGGTAAATTGAGG + Intergenic
1115395463 14:32903619-32903641 CTCATATAACTGGAAAGTATGGG + Intergenic
1116460526 14:45167638-45167660 CTCAATTACCAGGTAAATATGGG - Intronic
1120446381 14:84601316-84601338 CTCATTTACGAAGTGAGTTTGGG + Intergenic
1120814421 14:88839561-88839583 CTCAAGTTCCACGTAAGTATTGG + Exonic
1121813854 14:96914242-96914264 GACATTTACCAGGTAATTCTAGG - Intronic
1125470414 15:39996895-39996917 ATAATTTACCAGGGAATTATAGG - Intronic
1136666665 16:31818843-31818865 CTCATTTACCATGAAAGTAATGG + Intergenic
1137610712 16:49815394-49815416 CTCATTCACAAGGGAAGTAGGGG + Intronic
1140253187 16:73312903-73312925 CTCATTTTACAGATAAGTTTTGG + Intergenic
1144868291 17:18351444-18351466 CTCTTTTAAAAGGTAATTATTGG - Intronic
1146967487 17:37045278-37045300 CTTATTTACCACGTAAGTGGAGG - Intronic
1150537945 17:66063734-66063756 CTCATCTAAAAGATAAGTATAGG + Intronic
1153679878 18:7490558-7490580 CTCCTGTACCATGTAAATATGGG + Intergenic
1165486900 19:36101763-36101785 CCCATTTCCCAGGTAAGCAGGGG + Exonic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
930237023 2:48898245-48898267 CTCATCGACCATGTAAGTTTTGG + Intergenic
935329194 2:101963964-101963986 CCCACTTACCAGGTAAATTTAGG - Intergenic
939141383 2:138358624-138358646 TTCATGTACAAGGTAAGCATGGG - Intergenic
939279572 2:140044901-140044923 CTCCTATGCAAGGTAAGTATGGG - Intergenic
939546148 2:143556121-143556143 TTCATTTACAAGGAAAATATAGG - Intronic
939852324 2:147317023-147317045 GTCATTTGCCAGGGAAGGATTGG - Intergenic
944024363 2:195145498-195145520 CTCAGTTACCAGGTAAAGTTAGG + Intergenic
944133007 2:196367375-196367397 CTCATGTACCCTGTAAATATAGG - Intronic
946638608 2:221758179-221758201 GTCACTTACCTGGTAAATATAGG + Intergenic
946640089 2:221774752-221774774 CCCATTTACCAGGAATGTGTGGG - Intergenic
946835128 2:223764737-223764759 CTCCTTTCCCAGGGAAGCATAGG + Intronic
948028978 2:234800992-234801014 CTCATTTAACAAGTATTTATTGG - Intergenic
1173074947 20:39809082-39809104 CTTATTTTCCAGGCATGTATTGG + Intergenic
1175086047 20:56459788-56459810 CTCATTTAACACTTATGTATTGG + Intronic
1177135741 21:17303972-17303994 GTCATTTGCCAGGGAAGGATTGG - Intergenic
1177182702 21:17760108-17760130 CACAATTACCAGGTAAATTTAGG + Intergenic
1178088441 21:29136371-29136393 CTCATTTACTATGAAAGTCTAGG - Intronic
1182718186 22:32376710-32376732 CTCACTTCCCAGGTAAGGACAGG + Intronic
949123823 3:421255-421277 CTCATGCACCAGGTTAGTGTGGG + Intergenic
952358377 3:32605472-32605494 CTCAATTACCAGGTGAATTTAGG + Intergenic
952849070 3:37712916-37712938 CTCATTTACCAATGAAGTGTTGG + Intronic
954231620 3:49222267-49222289 GTCATTTGCCAGGGAAGGATTGG + Intronic
954910332 3:54101236-54101258 TCAATTGACCAGGTAAGTATGGG + Intergenic
956450186 3:69366480-69366502 CTCCCCTGCCAGGTAAGTATAGG + Intronic
957285218 3:78208995-78209017 CCCATTTACCAGCACAGTATTGG + Intergenic
960624437 3:119666972-119666994 CTTATTTTACAGGTGAGTATAGG - Intronic
966145500 3:176807331-176807353 CTCATTTGCCAGTTTATTATTGG - Intergenic
967530227 3:190540964-190540986 CTCAATTACCAGGTAAAGTTAGG - Intronic
968550510 4:1221212-1221234 CTCACTTATCAGGAAACTATAGG + Intronic
970962976 4:21895020-21895042 CTCATTTTCCAGGTGAGTTGGGG + Intronic
972699316 4:41478834-41478856 CTCATTTGCCAGTTCACTATTGG - Intronic
972719684 4:41683500-41683522 CTGAGTTACCAGATAGGTATTGG + Intronic
973546900 4:51991296-51991318 CATATTTACGAGGTGAGTATAGG + Intergenic
974537599 4:63190730-63190752 GTCATTTGCCAGGGAAGGATTGG - Intergenic
974660745 4:64885381-64885403 CTTATTTAACAGGTAAGATTGGG - Intergenic
975074544 4:70188909-70188931 CTCATTAACCACGTAACTTTGGG + Intergenic
975663927 4:76715273-76715295 CTCATTTCCCAGGTATATATAGG + Intronic
977884837 4:102243164-102243186 GTCATTTGCCAGGGAAGGATTGG - Intergenic
979409962 4:120365222-120365244 CACATTTACCATGTAACTGTGGG - Intergenic
983082440 4:163403196-163403218 CCCAATTACCAAGTAAATATAGG + Intergenic
984939256 4:184917174-184917196 GTCATTTGCCAGGGAAGGATTGG + Intergenic
988942466 5:36159964-36159986 CTCCTTTCCCAGTTAAGTCTGGG - Intronic
990625623 5:57607047-57607069 TTCATTTCCCAAATAAGTATTGG - Intergenic
992050037 5:72933381-72933403 GTCATTTGCCAGGGAAGGATTGG - Intergenic
993397501 5:87408552-87408574 CATATGTACCATGTAAGTATGGG + Intronic
994231075 5:97311126-97311148 GTCATTTGCCAGGGAAGGATTGG + Intergenic
995638175 5:114219579-114219601 CTCATCTACCAGCTGAGTCTGGG + Intergenic
995707084 5:114997463-114997485 GTCATTTGCCAGGGAAGGATTGG - Intergenic
996680872 5:126227241-126227263 GTCATTTGCCAGGGAAGGATTGG - Intergenic
997072966 5:130640110-130640132 GTCATTTGCCAGGTAAGGACTGG - Intergenic
1001445769 5:171781600-171781622 GTCTTATACCAGGTAAGTTTAGG - Intergenic
1003992812 6:11503652-11503674 CTCATTTACCAGGTAAGTATTGG + Intergenic
1004789736 6:19011616-19011638 CTCTTTTTCCAGGTAAGTTAAGG - Intergenic
1006782209 6:36639653-36639675 CTCCCCTGCCAGGTAAGTATAGG + Intergenic
1009385301 6:63079645-63079667 GTCATTTGCCAGGGAAGGATTGG + Intergenic
1011154908 6:84320135-84320157 TTAATTTACCAGGTATTTATTGG + Intergenic
1013907183 6:115233998-115234020 GTCATTTGCCAGGGAAGGATTGG + Intergenic
1013974888 6:116065559-116065581 CTTATTTGCCAGATAAATATGGG + Intergenic
1014502630 6:122211645-122211667 CTCCCCTGCCAGGTAAGTATAGG - Intergenic
1015040018 6:128705002-128705024 CTCATTTATATAGTAAGTATAGG + Intergenic
1016620837 6:146107677-146107699 CACATTTGACAGGTAAGTTTGGG + Intronic
1017101617 6:150854188-150854210 GTCATTTGCCAGGGAAGGATTGG - Intergenic
1017758713 6:157551565-157551587 CTGATTTACCAGGTGAGTCAGGG - Intronic
1018310919 6:162507629-162507651 CACATTTACAAGGTATGTATAGG + Intronic
1020990342 7:15187747-15187769 CTCATTCACCATGCAAGTAGAGG + Intergenic
1024691007 7:51803254-51803276 CTCATTTTCAAGGCAAGTAATGG - Intergenic
1024862127 7:53857039-53857061 CTTATTTACCTGATGAGTATAGG - Intergenic
1025798198 7:64759347-64759369 GTCATTTGCCAGGGAAGGATTGG + Intergenic
1027791696 7:82643620-82643642 GTCATTTTCCAGGGAAGGATTGG - Intergenic
1027927661 7:84487434-84487456 CTCATGTTCCAGGGAAATATTGG - Intronic
1029809153 7:103029842-103029864 CTCATTTACCAAGCAGGAATAGG + Intronic
1029983216 7:104898424-104898446 CTCAATTACCAGGTGAATTTAGG - Intronic
1030433259 7:109480679-109480701 CTCATTTTCCTGGTCAGTAAAGG - Intergenic
1033042490 7:137930826-137930848 CACAATTACCAGGGAAGTTTGGG + Intronic
1038279625 8:26152219-26152241 GTCACTTAACAGGTAAGTAATGG + Intergenic
1039692527 8:39878315-39878337 GTCATTTGCCAGGGAAGGATTGG + Intergenic
1040649581 8:49433291-49433313 GTCATTTACCAGGGAAGGATTGG - Intergenic
1042909468 8:73810783-73810805 CTCATTAACTCAGTAAGTATTGG + Intronic
1043308790 8:78832130-78832152 CTCATTTACCAGCATACTATTGG + Intergenic
1044129842 8:88508376-88508398 TTCATTTTCCAGGTAAATAAAGG - Intergenic
1047826589 8:128582534-128582556 CTCATTTCCTATGTAAGTCTGGG + Intergenic
1048554928 8:135466336-135466358 CTCATTTTACAGGTAAGAAGTGG + Intronic
1051994602 9:23200176-23200198 CTCCGTTTCCAGGTAATTATGGG + Intergenic
1052057141 9:23918711-23918733 GTCATTTGCCAGGGAAGGATTGG + Intergenic
1054923877 9:70569050-70569072 CTCATTTACAAAGGAATTATTGG - Intronic
1055212398 9:73812567-73812589 CTAATTTTCCAGGTTAGCATTGG + Intergenic
1056392128 9:86150136-86150158 GTCATTTTCCAGGGAAGGATTGG + Intergenic
1058978903 9:110151062-110151084 TTCATTTAATAAGTAAGTATGGG - Intronic
1187321376 X:18241002-18241024 AGCATTTAACAGGTTAGTATTGG - Exonic
1187462310 X:19498634-19498656 CTCATTATCCAGGAAAGTACAGG - Intronic
1192375118 X:70551488-70551510 CTCATGTACCCCATAAGTATGGG + Intronic
1193946519 X:87742641-87742663 CTCATTTCCCATGAAAGGATGGG - Intergenic
1195440009 X:104888647-104888669 GTCATTTGCCAGGGAAGGATTGG - Intronic
1195753675 X:108180504-108180526 CTGAATTACCAGGTAAGAAAAGG - Exonic
1196489380 X:116248845-116248867 GTCATTTGCCAGGGAAGGATTGG - Intergenic
1201311511 Y:12601961-12601983 GTCATTTGCCAGGGAAGGATTGG + Intergenic
1201455781 Y:14165698-14165720 GTCATTTGCCAGGGAAGGATTGG - Intergenic
1201496009 Y:14592030-14592052 GTCATTTGCCAGGGAAGTATTGG + Intronic
1201631843 Y:16078385-16078407 GTCATTTGCCAGGGAAGGATTGG - Intergenic
1201650048 Y:16275238-16275260 GTCATTTACCAGGGAAGGATTGG - Intergenic