ID: 1003996396

View in Genome Browser
Species Human (GRCh38)
Location 6:11545165-11545187
Sequence CTGTGTCAGCAGCAAATGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1003996392_1003996396 15 Left 1003996392 6:11545127-11545149 CCTGGGAAAAAGATGAGGGCTGC 0: 1
1: 0
2: 1
3: 26
4: 211
Right 1003996396 6:11545165-11545187 CTGTGTCAGCAGCAAATGTAGGG No data
1003996391_1003996396 16 Left 1003996391 6:11545126-11545148 CCCTGGGAAAAAGATGAGGGCTG 0: 1
1: 0
2: 1
3: 34
4: 281
Right 1003996396 6:11545165-11545187 CTGTGTCAGCAGCAAATGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1003996396 Original CRISPR CTGTGTCAGCAGCAAATGTA GGG Intronic
No off target data available for this crispr