ID: 1004000472

View in Genome Browser
Species Human (GRCh38)
Location 6:11592684-11592706
Sequence AGGTCTGGGCCGAATGTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004000467_1004000472 9 Left 1004000467 6:11592652-11592674 CCCAAGTTTGCAACTGGCAAATG No data
Right 1004000472 6:11592684-11592706 AGGTCTGGGCCGAATGTCACAGG No data
1004000464_1004000472 22 Left 1004000464 6:11592639-11592661 CCCTCATATAAAACCCAAGTTTG No data
Right 1004000472 6:11592684-11592706 AGGTCTGGGCCGAATGTCACAGG No data
1004000468_1004000472 8 Left 1004000468 6:11592653-11592675 CCAAGTTTGCAACTGGCAAATGT No data
Right 1004000472 6:11592684-11592706 AGGTCTGGGCCGAATGTCACAGG No data
1004000465_1004000472 21 Left 1004000465 6:11592640-11592662 CCTCATATAAAACCCAAGTTTGC No data
Right 1004000472 6:11592684-11592706 AGGTCTGGGCCGAATGTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004000472 Original CRISPR AGGTCTGGGCCGAATGTCAC AGG Intergenic