ID: 1004001168

View in Genome Browser
Species Human (GRCh38)
Location 6:11598508-11598530
Sequence ATGCAGCTTGTTCTCTAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004001149_1004001168 29 Left 1004001149 6:11598456-11598478 CCAGAGCACAGCCCCCAGGCCCA No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001152_1004001168 16 Left 1004001152 6:11598469-11598491 CCCAGGCCCACCCTCCCAGTCCC No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001163_1004001168 -4 Left 1004001163 6:11598489-11598511 CCCCTGGCAATGCCCAGGGATGC No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001164_1004001168 -5 Left 1004001164 6:11598490-11598512 CCCTGGCAATGCCCAGGGATGCA No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001153_1004001168 15 Left 1004001153 6:11598470-11598492 CCAGGCCCACCCTCCCAGTCCCC No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001158_1004001168 5 Left 1004001158 6:11598480-11598502 CCTCCCAGTCCCCTGGCAATGCC No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001159_1004001168 2 Left 1004001159 6:11598483-11598505 CCCAGTCCCCTGGCAATGCCCAG No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001155_1004001168 10 Left 1004001155 6:11598475-11598497 CCCACCCTCCCAGTCCCCTGGCA No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001151_1004001168 17 Left 1004001151 6:11598468-11598490 CCCCAGGCCCACCCTCCCAGTCC No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001160_1004001168 1 Left 1004001160 6:11598484-11598506 CCAGTCCCCTGGCAATGCCCAGG No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001156_1004001168 9 Left 1004001156 6:11598476-11598498 CCACCCTCCCAGTCCCCTGGCAA No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001157_1004001168 6 Left 1004001157 6:11598479-11598501 CCCTCCCAGTCCCCTGGCAATGC No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001165_1004001168 -6 Left 1004001165 6:11598491-11598513 CCTGGCAATGCCCAGGGATGCAG No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data
1004001150_1004001168 18 Left 1004001150 6:11598467-11598489 CCCCCAGGCCCACCCTCCCAGTC No data
Right 1004001168 6:11598508-11598530 ATGCAGCTTGTTCTCTAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004001168 Original CRISPR ATGCAGCTTGTTCTCTAGCC AGG Intergenic
No off target data available for this crispr