ID: 1004002400

View in Genome Browser
Species Human (GRCh38)
Location 6:11607266-11607288
Sequence CAGTTTGCACCGATTGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004002394_1004002400 12 Left 1004002394 6:11607231-11607253 CCTATGGATTAGAGAGGAAGCAA No data
Right 1004002400 6:11607266-11607288 CAGTTTGCACCGATTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004002400 Original CRISPR CAGTTTGCACCGATTGGGGC AGG Intergenic
No off target data available for this crispr