ID: 1004005377

View in Genome Browser
Species Human (GRCh38)
Location 6:11633095-11633117
Sequence CACAAGGACTAGCCTACACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004005377_1004005381 10 Left 1004005377 6:11633095-11633117 CCAGGTGTAGGCTAGTCCTTGTG No data
Right 1004005381 6:11633128-11633150 CAAATATCATCATTCTCTGTGGG No data
1004005377_1004005380 9 Left 1004005377 6:11633095-11633117 CCAGGTGTAGGCTAGTCCTTGTG No data
Right 1004005380 6:11633127-11633149 ACAAATATCATCATTCTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004005377 Original CRISPR CACAAGGACTAGCCTACACC TGG (reversed) Intergenic
No off target data available for this crispr