ID: 1004010257

View in Genome Browser
Species Human (GRCh38)
Location 6:11678591-11678613
Sequence GACTGATGAGTTTTAGCATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004010257_1004010259 19 Left 1004010257 6:11678591-11678613 CCTAATGCTAAAACTCATCAGTC No data
Right 1004010259 6:11678633-11678655 TTATTTATTTTTTTGTTCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004010257 Original CRISPR GACTGATGAGTTTTAGCATT AGG (reversed) Intergenic
No off target data available for this crispr