ID: 1004015645

View in Genome Browser
Species Human (GRCh38)
Location 6:11729483-11729505
Sequence TCTCAGGGACAGGAGGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 635
Summary {0: 1, 1: 1, 2: 2, 3: 53, 4: 578}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004015645_1004015656 -6 Left 1004015645 6:11729483-11729505 CCTTCCCCCTCCTGTCCCTGAGA 0: 1
1: 1
2: 2
3: 53
4: 578
Right 1004015656 6:11729500-11729522 CTGAGAGGAGGGCCTTTCCCTGG 0: 1
1: 0
2: 0
3: 43
4: 336

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004015645 Original CRISPR TCTCAGGGACAGGAGGGGGA AGG (reversed) Intronic
900278973 1:1853094-1853116 GCACAGGGGCAGGAGGGGAAAGG - Intronic
900496580 1:2978603-2978625 GCACACGGACAGGAGGGGGACGG + Intergenic
900767070 1:4512834-4512856 TTTCAGGGCCAGGAGGGGCTGGG + Intergenic
900983973 1:6062572-6062594 TCCCAGGGACACCAGGGGGTGGG - Intronic
901143156 1:7048634-7048656 GCTCAGGGACAGGTGGTGGTGGG - Intronic
901638632 1:10682034-10682056 GGACAGGGACAGGAGGTGGAGGG - Intronic
901735196 1:11307992-11308014 GCTAAGGGACAGGAGGCAGAGGG - Intergenic
901769631 1:11523812-11523834 GCCCAGGGACTGGAGGGGGTGGG - Intronic
901869027 1:12126664-12126686 GCCCAGGGGCAGGAGGGGAAAGG + Intronic
902702412 1:18181548-18181570 TGTCAGGAGCAGGAAGGGGAAGG - Intronic
902725421 1:18332669-18332691 GATCAGGGAGTGGAGGGGGACGG + Intronic
903188488 1:21642821-21642843 TTCCAGGGACAGGAGGTGGCAGG - Intronic
903283128 1:22261549-22261571 GCTGAGGGACAGGAGGTGGTGGG + Intergenic
903747937 1:25601236-25601258 ACTAAGGGAAAGTAGGGGGAAGG - Intergenic
903789931 1:25885913-25885935 GCCAAGGGACAGGAGGTGGAGGG + Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
903946225 1:26965164-26965186 TATCAGGGGCTGGAGGGAGAGGG + Intergenic
904237209 1:29123395-29123417 ACTCAGGGACAAGGAGGGGATGG - Intronic
905788998 1:40780394-40780416 TCTTGGGGACAGGAGTGGGGAGG - Intergenic
906523600 1:46481161-46481183 ACTTACGGAGAGGAGGGGGAGGG + Intergenic
906715485 1:47965509-47965531 TCTCAGGAAAAGGGGAGGGAAGG - Intronic
907725276 1:57015005-57015027 TCTGAGGTACAGGTGAGGGAGGG + Exonic
907978169 1:59453867-59453889 TGTGGGGGACAGGAGGAGGAGGG + Intronic
908804003 1:67910855-67910877 TGCCAGGGTTAGGAGGGGGAGGG - Intergenic
909374986 1:74929915-74929937 TGTGAGGGATAGGAGGAGGAGGG + Intergenic
909759452 1:79270503-79270525 TCTCAGGGAGAGGAAGGAAAGGG + Intergenic
910745374 1:90568720-90568742 TCTCAGAAAGAGGAGTGGGAAGG - Intergenic
912554915 1:110508800-110508822 TGTCAGGGACACCAGAGGGAGGG + Intergenic
912821682 1:112872762-112872784 AGTCAGAGACAGGAGCGGGAGGG - Intergenic
912923449 1:113891976-113891998 CCTCAGGGACAGGAAAGGGAGGG - Intergenic
913509417 1:119548361-119548383 TCTGAGGGCCAGGATGGGGCTGG + Intergenic
916213255 1:162375085-162375107 TTTCAGAGACAGGAGAGGGGAGG + Intronic
916244327 1:162671792-162671814 TATCAGAGACAGGAAAGGGAAGG - Intronic
917028015 1:170663176-170663198 TCCCAGGGAAAGGAGGAAGAAGG + Intronic
917273683 1:173306419-173306441 CCTCAGGGACTGGAGTGAGATGG + Intergenic
918284918 1:183042803-183042825 TCTCAGTGCCAGGAGAGGGCTGG - Intronic
919776014 1:201194397-201194419 CCTCAAGGATAGGAGGGAGATGG - Intronic
919839690 1:201599751-201599773 GCTCAGGGACAGGGGGAGGGAGG + Intergenic
920376744 1:205512847-205512869 TCTCAGTCTCAGGAGGGGGAGGG - Intronic
920418017 1:205811726-205811748 TCTCAAGGGCAGGAGTGGGTAGG - Intronic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
920948925 1:210554774-210554796 TCTGAGGGTCAGGAGAGAGATGG + Intronic
920956023 1:210620837-210620859 TCTCAGAGATAGGAAGGAGAGGG - Intronic
921252510 1:213311033-213311055 TCTCAGGGTTAGGAGGGTGCTGG + Intergenic
922121657 1:222675663-222675685 TCTCTTGGACAGGAAGGAGAAGG + Intronic
922304162 1:224329860-224329882 TCTCAGGGAGAAGCCGGGGATGG - Intronic
922352802 1:224748098-224748120 TTCCAGGTACAGGAGGAGGAGGG - Intergenic
922363962 1:224846531-224846553 TATCTTGGCCAGGAGGGGGAGGG - Intergenic
922746014 1:228044458-228044480 TCTCAGGGGCATGAGGGACAGGG - Intronic
923014372 1:230114510-230114532 TCTCAGCGAGAGGAGGGGCTTGG + Intronic
923406534 1:233666667-233666689 CGTCAGGAACAGGAGGGTGAAGG - Exonic
923441027 1:234020794-234020816 TCTCAGGGCTAGGAGAGGAATGG - Intronic
923663202 1:235976911-235976933 TCTGAGGTACAGGATGGGGCTGG - Exonic
924553520 1:245099530-245099552 TCTCTGGGCCAGGAATGGGAAGG - Intronic
924946537 1:248850521-248850543 AGTCAGGGACAGAAGAGGGAAGG + Intronic
1063353039 10:5373922-5373944 TCTTCGGGAGAGGAGGAGGAGGG + Exonic
1065523487 10:26594221-26594243 TCTTGGCGACAGCAGGGGGAGGG - Intergenic
1066065480 10:31758618-31758640 GCTCAGGGATAGGAAGGGGTAGG - Intergenic
1066290841 10:34013150-34013172 TCTCAGGGTCAGGAGGTGAGGGG - Intergenic
1067381174 10:45774965-45774987 TTGCAGGGTCAGGAGAGGGATGG + Intronic
1067888872 10:50115594-50115616 TTGCAGGGTCAGGAGAGGGATGG + Intronic
1068775498 10:60863994-60864016 GCTCAGGCAGTGGAGGGGGAGGG - Intergenic
1069020796 10:63486251-63486273 TTTAAGGGACAGCAGGGGCAGGG + Intergenic
1069171804 10:65240411-65240433 TGCCAGGGACTGGAGGGAGAGGG + Intergenic
1069665151 10:70149944-70149966 TCTCTGCAACAGGATGGGGATGG - Exonic
1069982318 10:72260993-72261015 ACTGAGGAACGGGAGGGGGATGG - Intergenic
1070268747 10:74931237-74931259 ACCCAGGGACAGGAGAGGAAAGG - Intronic
1070548733 10:77474044-77474066 TCTCAGGGACATTAGAGAGAGGG - Intronic
1070610431 10:77928509-77928531 TCTCAGGAGCAGGACTGGGAGGG - Intergenic
1071565077 10:86667544-86667566 ACACAGGGCCAGGAGGGGCAGGG - Intergenic
1072309099 10:94137205-94137227 GCACAGGGACAGGAAGTGGAAGG - Intronic
1073442219 10:103558992-103559014 CCTCTGTGACAGGAGGGGGTGGG - Intronic
1073930971 10:108576342-108576364 TCTGAGGTACATGAGGAGGATGG + Intergenic
1074192221 10:111148000-111148022 TCCTGGGGACAGGAGGAGGAGGG + Intergenic
1074402264 10:113151899-113151921 TCTCAGGGAGAAGCGGGGGGCGG + Intronic
1074469439 10:113714159-113714181 TGTCAGGGGCAGGTGAGGGAGGG - Intronic
1074856458 10:117477609-117477631 TCTCAGGGAGAAGAGGGGCTGGG + Intergenic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1075681924 10:124339446-124339468 CCTCAGGGACAGGAAGGGGCTGG - Intergenic
1075689439 10:124385704-124385726 TCTCAGGTGCAGGAGGCTGAGGG + Intergenic
1076350339 10:129811075-129811097 TCCCAGGGGCTGGAGGGTGAAGG - Intergenic
1076511777 10:131019389-131019411 TGTCAGGGCGAGGAGAGGGACGG - Intergenic
1076518397 10:131062883-131062905 TCCCAGGCAGAGGAGGGGCACGG + Intergenic
1076643516 10:131935330-131935352 ACTCAGAGACAGGAAGGGCAAGG - Intronic
1076713185 10:132350353-132350375 TCTCAGGGTCCTGAGGGGTATGG - Intronic
1077287202 11:1772956-1772978 GCCCAGGCACAGGTGGGGGAGGG + Intergenic
1078617756 11:12881133-12881155 TCTCAGGGCCTGGAGGAGAAAGG + Intronic
1081467689 11:43337484-43337506 TCTCAGAGTCTGGAGGGGAAGGG - Intronic
1082749640 11:57002274-57002296 TGTCAGGTTCAGGATGGGGATGG + Intergenic
1082833923 11:57638728-57638750 TCTTGGGGAAGGGAGGGGGACGG + Intergenic
1083276474 11:61599812-61599834 TCTGAGGGGCAGGAGGGGAGGGG + Intergenic
1083761965 11:64823691-64823713 GGACAGGGACAGGATGGGGAGGG - Exonic
1083909579 11:65698363-65698385 AGTCAGGGACTGGAGTGGGAGGG - Intergenic
1084056756 11:66638910-66638932 TCTCAGGGGGCGGTGGGGGAAGG - Intronic
1084120893 11:67068366-67068388 CCCCAGGGAGAGGAGGAGGAGGG + Intronic
1084737479 11:71114902-71114924 TCTCTGGGGCAGGAGGGTAAAGG + Intronic
1085261571 11:75208500-75208522 TTTCAGGGACAGAAGGGGAAGGG - Intergenic
1085265468 11:75235563-75235585 AGTCAGGGACAGGAGTGGGTAGG - Intergenic
1085297737 11:75440357-75440379 TCTATGGGAGAGGAGGGTGAAGG - Intronic
1085308819 11:75503961-75503983 TCTCAGGGACTGGAGGGGGAAGG + Intronic
1086928180 11:92663459-92663481 TCTCAAGCTCAGGAGAGGGATGG - Intronic
1087014272 11:93541251-93541273 TCTAGGGGACAGGAGCGGGGTGG + Intronic
1087094205 11:94304831-94304853 TCTCAGGGGGAGGAGGGAGCAGG + Intergenic
1088432854 11:109777700-109777722 TGTCAGGGGCAGGAGGATGATGG - Intergenic
1088834089 11:113562485-113562507 TCTCAGGGACAGGAGATGCAAGG + Intergenic
1089353246 11:117833396-117833418 TGGCAGGGACTGGAGGGGGTGGG - Intronic
1089700649 11:120241969-120241991 TCACAGGGACAGGGTGGAGAAGG - Intronic
1090144854 11:124310668-124310690 TCCCAGGAACAGGAGGAAGAGGG + Exonic
1090420616 11:126572681-126572703 TCTCAGGGACTGGAGAGGCAGGG + Intronic
1090888414 11:130900079-130900101 TGTCAGGGACAGGAATGGAAAGG + Intronic
1090925139 11:131242976-131242998 TCTCAGTTAGAGGAGGGGAAGGG - Intergenic
1091083623 11:132697436-132697458 TGTCAGGGACTGGAGGAGGAGGG - Intronic
1091596280 12:1881117-1881139 AGTCAGGGACAGGAGAGGGAAGG + Intronic
1091741743 12:2964253-2964275 TCTCAGGGGCTTGAGGGGAAGGG - Intronic
1092254290 12:6917741-6917763 TCCCAGGGGCGGGTGGGGGAGGG + Intronic
1092290795 12:7158476-7158498 TCCCATGGACAGGAGAGAGAAGG - Exonic
1092466790 12:8740490-8740512 ACTCAGGGAGAAGAGTGGGAGGG - Intronic
1093112656 12:15170300-15170322 ACTCTGGCACAGGAGGCGGATGG + Intronic
1093715332 12:22375693-22375715 TCCCAGGGACAGGAGAGGCCGGG - Intronic
1093761327 12:22914812-22914834 TTTCAGGGGCAGGAGGCAGATGG - Intergenic
1093866238 12:24230294-24230316 TCTCAGAAACAGGAGGGGTCTGG - Intergenic
1094051419 12:26224827-26224849 TCTCAGGGCAAAGTGGGGGACGG + Intronic
1094682699 12:32679725-32679747 TCCCGGGGACAGGAGAGGGAAGG + Intronic
1095361404 12:41345325-41345347 ACACACCGACAGGAGGGGGAGGG - Intronic
1095403647 12:41843236-41843258 TGTCAGGGAGTGCAGGGGGAGGG + Intergenic
1095542728 12:43329875-43329897 TCCCAGGCACTGGAGGGGTAAGG + Intergenic
1095959370 12:47824443-47824465 GCACTGGGACAGGATGGGGAGGG + Intronic
1096259642 12:50082615-50082637 TCTCAGAGACAAGAGGGGATGGG - Exonic
1096607714 12:52778363-52778385 GCTCAGGGACCGGAGGGGTATGG - Intergenic
1096622230 12:52872094-52872116 TTTGAGGGAGAGGAGGGGCATGG - Intergenic
1096624960 12:52889085-52889107 TCTCAGGCACAGGATGGAGGAGG - Intergenic
1097188077 12:57206214-57206236 TCTCTGGGTCTGGAGGGGCAGGG + Intronic
1097346459 12:58498744-58498766 TCTCATGCACAGGAGGTTGAAGG + Intergenic
1097609290 12:61798558-61798580 TGTCAGGGACTGGAGGAAGAGGG - Intronic
1097945892 12:65366958-65366980 CTTAAGGGACAGGAGGAGGAGGG + Intronic
1099471715 12:83058437-83058459 TCTCAGGGCCAGGAAGGGTAAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1102060972 12:109930814-109930836 TCCCTGGGACAGCAGGGGCAGGG + Exonic
1102534887 12:113574189-113574211 TCAGAGGGGCAGGAGGGGGTCGG + Intergenic
1102644854 12:114397175-114397197 TTTCAGGGAAAGGAGGGGACTGG - Intronic
1102718572 12:114996488-114996510 TCTCAGGGACCTGTGGGTGAGGG - Intergenic
1103224735 12:119276986-119277008 TATCAGGGTCAGGGGGTGGAGGG + Intergenic
1104477608 12:129083543-129083565 TCTCAGGGACAGTTGGGAGCTGG - Intronic
1104588506 12:130066264-130066286 ACTCAGGGACAGGATAAGGATGG + Intergenic
1104837160 12:131799187-131799209 TGACAGGGACAGGAGGGACAGGG - Intronic
1105209080 13:18247379-18247401 GCTCAGGGACAAGTGGGGGCTGG - Intergenic
1105519186 13:21116273-21116295 CTTCAGGGACTGCAGGGGGATGG - Intergenic
1106229929 13:27813953-27813975 TGTCAGGGGCAGGAGGGTGGCGG - Intergenic
1106300798 13:28462902-28462924 TCTCAGTGGCAGGAGGAGGTCGG - Intronic
1106413905 13:29529959-29529981 TGTCAGAGACATGAGGGTGATGG + Intronic
1107664227 13:42672644-42672666 TCCCAGGGACAGAGGGGGGCAGG + Intergenic
1110667702 13:78137427-78137449 TTTCAGAGAAAGGAGGGGGCAGG + Intergenic
1111111433 13:83715341-83715363 TCTCAGGGTCAGGAAAAGGATGG + Intergenic
1111233433 13:85375131-85375153 TGTCAGGGACAGGTGAGAGAAGG + Intergenic
1112280211 13:98056262-98056284 TCTCAGGGCCTGGAGGAAGAGGG + Intergenic
1112417970 13:99219723-99219745 TGTCAGGGACAGTTGGGAGAAGG - Intronic
1113135973 13:107090052-107090074 TCCAGGGGACAGGAGGGGAAAGG - Intergenic
1114042125 14:18688645-18688667 ACTCAGGGAGAGGAGGTGAATGG + Intergenic
1114461660 14:22890019-22890041 CCTCAGGGACATGAAGAGGAGGG + Intergenic
1114646405 14:24258886-24258908 CCTAAGGGAAAGGAGGGAGAAGG - Intronic
1115243251 14:31270132-31270154 TCATAGGCACAGGATGGGGAAGG - Intergenic
1115460830 14:33658684-33658706 TGTCAGGGGGAGGATGGGGAAGG + Intronic
1115753564 14:36513640-36513662 CCTCAAGGCCAGGAGGGGGGTGG - Exonic
1116858902 14:49978224-49978246 TCTATGGGAGAGGAGGGGGTGGG + Intergenic
1116950874 14:50877442-50877464 TGGCAGGGACAGGAAGGGAAGGG - Intronic
1118389227 14:65282238-65282260 TCTCAGAGAGAGGATGGGGTGGG - Intergenic
1118744863 14:68766553-68766575 GCTCTGGGCTAGGAGGGGGATGG - Intergenic
1119266172 14:73264367-73264389 TCTCAGGGGCCCGAGTGGGAAGG + Intronic
1119326273 14:73761250-73761272 TCTCAGGGAGAAGAGGAGGGAGG + Intronic
1119594135 14:75918095-75918117 TTTCAGTGAGAAGAGGGGGAAGG + Intronic
1121043744 14:90773084-90773106 CTTCAGGGACAGGAGGGGCAAGG + Intronic
1121079535 14:91096418-91096440 TCTCAGGGCCGGGGGTGGGAAGG + Intronic
1121270341 14:92633416-92633438 CCTCTGGGACAGGAGGGTGGCGG - Intronic
1121273108 14:92651072-92651094 TCACAGGCACACGAGGAGGAAGG - Intronic
1121305699 14:92905574-92905596 TCTTAGGGAGAGGCTGGGGAAGG + Intergenic
1121473734 14:94175115-94175137 TCTCCGGGAGAGGTGGGGGGAGG - Intronic
1121621874 14:95355919-95355941 TCTCCAGGACAGGAGGGAAAGGG - Intergenic
1122466616 14:101938174-101938196 TCTCAGGGACTGGGCTGGGAGGG - Intergenic
1122826283 14:104372386-104372408 TGGCAAGGATAGGAGGGGGATGG + Intergenic
1122976841 14:105174293-105174315 ATTCTGGAACAGGAGGGGGAGGG + Intronic
1122986391 14:105213630-105213652 CCTCAGTGCCAGGTGGGGGAGGG - Intronic
1123075599 14:105666023-105666045 TGTCAGGGACAGGAGGAGACAGG + Intergenic
1123090053 14:105738458-105738480 TGTCAGGGATAGGAGGGGACAGG + Intergenic
1124504916 15:30264350-30264372 TCTCTGGGACTGGATGGGGGTGG + Intergenic
1124738636 15:32274285-32274307 TCTCTGGGACTGGATGGGGGTGG - Intergenic
1125414444 15:39437881-39437903 TCAGAGGGACAGGAGGGGTGGGG + Intergenic
1125485290 15:40107412-40107434 GCTCAGGGACAGGGATGGGATGG - Intronic
1126676326 15:51161910-51161932 TATCAGCAAGAGGAGGGGGAAGG - Intergenic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128388651 15:67167955-67167977 TGTCTGGGAAAGGTGGGGGAAGG - Intronic
1128637794 15:69314302-69314324 TAGGAGGGACAGGAGGGAGAAGG - Intronic
1128766081 15:70252018-70252040 TTTTAGGGACTGGAAGGGGAAGG + Intergenic
1129258409 15:74347860-74347882 TCCCAGGGACTGGAGGGAGGTGG - Intronic
1129426569 15:75467766-75467788 TCCCAGGGATGGGAGGCGGAGGG - Exonic
1129732363 15:77939583-77939605 TATGAGGGGCATGAGGGGGAAGG + Intergenic
1129944079 15:79524216-79524238 TCTGAGAGCCAGGAGTGGGAAGG - Intergenic
1130047156 15:80454228-80454250 TCTCAGTGACAGGGTGGTGAGGG + Intronic
1131135699 15:89933515-89933537 TCCCAGGGGCAGGAGTGGGAGGG + Intergenic
1131471860 15:92704525-92704547 TCGATGGGGCAGGAGGGGGAAGG - Intronic
1131968983 15:97873876-97873898 TTTAAGGGGCAGGAGGGGGCAGG - Intergenic
1132137334 15:99354447-99354469 CCTAAAGGAAAGGAGGGGGAAGG + Intronic
1132516210 16:367312-367334 TCTCAGGGGCAGCAAGGGCAGGG + Intergenic
1132529393 16:438107-438129 TCTCAGGAGGAGGTGGGGGAAGG - Intronic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1132722096 16:1321399-1321421 TCTCCTGGTCAGGAGGGGGGAGG + Intronic
1133612152 16:7443347-7443369 TGTGTGAGACAGGAGGGGGATGG - Intronic
1134765695 16:16755728-16755750 CCTCAGGGAGGGGAAGGGGAAGG - Intergenic
1134867311 16:17619958-17619980 TCACAGGGAAAGGAGGGGACAGG - Intergenic
1135027271 16:19008134-19008156 ACTCAGGGAGAAGAGGGGGCAGG - Intronic
1135183099 16:20292065-20292087 TGTCTGGGACAGTAGGGGGCAGG - Intergenic
1136120131 16:28127544-28127566 TCCCAGGGACAGGGTGAGGAAGG - Intronic
1136134890 16:28249711-28249733 ACTAAGGGCCAGGAGGTGGAAGG + Intergenic
1136377241 16:29872744-29872766 CTGCAGGGAGAGGAGGGGGAGGG + Intronic
1136788281 16:32948148-32948170 TAACAGGGACAGGCGGGGAAGGG + Intergenic
1137521493 16:49199147-49199169 CCTAATGGACAGGAGTGGGAAGG + Intergenic
1137733623 16:50708408-50708430 ACTCAGGAACAGGAGGGGCTTGG + Intronic
1138205234 16:55119775-55119797 GCTCTGGGACAGGAGGGTCAAGG + Intergenic
1138529698 16:57628365-57628387 GTTCAGGGACAGGAAGGGGCCGG - Intronic
1138565114 16:57827509-57827531 TCTGAGGGACAGGCAGGAGAAGG - Intronic
1139670784 16:68491393-68491415 CCTCAGGGGCAGGAGGGGAGGGG + Intergenic
1139909868 16:70391142-70391164 CCTCAGGGACGGGACTGGGAAGG + Intronic
1139956795 16:70697082-70697104 TCTGAGGGGCAGGAAGGGGCCGG - Intronic
1140105405 16:71955290-71955312 TGGCAGGGAGAGGAGTGGGAGGG + Intronic
1140307143 16:73813743-73813765 TCTGAGGTACAGGAAGAGGAGGG - Intergenic
1140408513 16:74726834-74726856 TCTCAGAGACAGGAGGCAGATGG - Intronic
1140990032 16:80201766-80201788 TCTGATGGAAAGGAGGGGGTAGG + Intergenic
1141138993 16:81484926-81484948 TTTCAGGGGTAGGAGGAGGAAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141201407 16:81901131-81901153 TCTCCGAGAGAGGATGGGGAAGG - Intronic
1141424384 16:83935762-83935784 TCCCAGGGAGAGGAGGCGGCTGG + Intronic
1141661386 16:85443445-85443467 TCTCAGTAACATGAGGAGGAAGG - Intergenic
1141675120 16:85513737-85513759 TCTCAGGAGCAGGACAGGGAAGG - Intergenic
1142239177 16:88937405-88937427 TCGCAGGGGCAGGAGAGGGGTGG - Intronic
1142707746 17:1707407-1707429 ACCCAGGGACAGATGGGGGAAGG - Exonic
1143272038 17:5683050-5683072 CCAGAGGGACAGGAGGGAGAGGG - Intergenic
1143480361 17:7224578-7224600 TCTCAAGGAGAGGAAAGGGAGGG - Intronic
1144239729 17:13298516-13298538 CCTCATGGCCCGGAGGGGGAAGG + Intergenic
1144528769 17:16015535-16015557 TTTCAAGGAAAGGAGGAGGAAGG - Intronic
1145242673 17:21248908-21248930 TCTCAGGCCCAGGAGGGAGGAGG - Intronic
1145991448 17:29081533-29081555 TCTCTGGGAGAGGATGAGGAAGG + Intronic
1146567714 17:33927809-33927831 TCTCAGGGGTAGGCAGGGGAGGG - Intronic
1146906621 17:36622196-36622218 CCATAGGGACAGGAGGGGGCAGG - Intergenic
1146958518 17:36952224-36952246 TCTCCTGGAAAGGTGGGGGATGG - Intronic
1147145867 17:38484184-38484206 TCTCAGGGGAAGGGGGAGGATGG + Intronic
1147155942 17:38544544-38544566 AATCAGAGACAGGAAGGGGAGGG + Intronic
1147256193 17:39183908-39183930 TCCCAGGAACAGCAGGTGGAGGG + Intronic
1147948791 17:44095573-44095595 AGCCAGGGACAGGAGGGGGCTGG + Intronic
1147949316 17:44098141-44098163 AGTCAGGGAAAGGAGGGGCATGG + Intronic
1148022930 17:44565629-44565651 GCTCAGGGACAAGAGGTGGAGGG - Intergenic
1148749058 17:49934434-49934456 TCACAGGGACAGGAGGGGCAGGG - Intergenic
1148850095 17:50550442-50550464 TCTCTGAGGCAGGCGGGGGAGGG - Intronic
1149696636 17:58621442-58621464 TCTCAGGGAGAGGAGAGAGAGGG + Intronic
1150215626 17:63467371-63467393 GGTCAGGGAGAGGAGGGAGAAGG - Intergenic
1150883212 17:69054791-69054813 TATGAGGGACAGGAGGGAGGAGG + Intronic
1151323715 17:73366333-73366355 TGGCCGGGACAGGAGGCGGACGG + Intronic
1151527611 17:74681655-74681677 TTTCAGGGAAAGGAGAGTGAGGG - Intronic
1151559704 17:74863734-74863756 TCTCAGGGCCAAGAGGAGGGCGG + Intronic
1151579509 17:74970307-74970329 TCTCAGGGTGTGCAGGGGGAAGG + Intronic
1151894793 17:76972768-76972790 TTTCAGGGCCAGGGGGCGGAGGG - Intergenic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152244465 17:79177885-79177907 TCTCAGGGGCTGGAGAGGGCCGG - Intronic
1152261442 17:79269465-79269487 TCTCAGAGGCAGGAGTGGGAAGG - Intronic
1152276500 17:79361051-79361073 TCTCAGGCAAAGGAAGGGAAAGG + Intronic
1152451391 17:80383227-80383249 ACTTGGGGACAGGAGGAGGATGG - Intronic
1152462651 17:80449615-80449637 TCCCTGGGACAGGTGGGGGGTGG + Intergenic
1152500123 17:80702454-80702476 TCTGAGAGACAGGAGAGGCACGG - Intronic
1152659895 17:81537301-81537323 TCTCAAGGACATGGGGAGGACGG + Intergenic
1154492068 18:14930204-14930226 TCTCAGGGACTGGCCTGGGATGG - Intergenic
1154501561 18:15000213-15000235 TCGCAGGGAGAGGACGGGGGAGG - Intergenic
1156584779 18:38420139-38420161 TCTCTGGGTCAGGAGGAGGTTGG + Intergenic
1156591455 18:38494152-38494174 TCTCATGGACAGGAGAGGTAAGG + Intergenic
1157106369 18:44778089-44778111 TTTCAGGGAGAAGAGAGGGAGGG - Intronic
1157272507 18:46287282-46287304 TCTCAGGAACAGGAGTGGTGAGG + Intergenic
1158293334 18:55966743-55966765 ACTCAAGGACAGGAGGAGTAGGG + Intergenic
1158543803 18:58379067-58379089 GCCCAGGCACAGGAGGGCGATGG + Intronic
1159927072 18:74279024-74279046 TCTGAGGGACAAGAGCAGGAGGG + Intronic
1160062924 18:75548956-75548978 TGTCGGGGAGAGGAGAGGGAAGG + Intergenic
1160072816 18:75643334-75643356 TCTGAAAGACAGGAGGGCGAGGG - Intergenic
1160165458 18:76507370-76507392 TCTCACGGACAGGTGGAGAAAGG + Intergenic
1160191134 18:76714689-76714711 TGTCAGGGAGAGGAGTGGGCTGG + Intergenic
1160408592 18:78659780-78659802 TCCCAGGGACAGCTGGGGGATGG - Intergenic
1160559804 18:79749245-79749267 AAGCAGGGAGAGGAGGGGGAGGG - Intronic
1160563242 18:79771897-79771919 GCTCAGGAACAGGAGGGAGGAGG - Intergenic
1160760195 19:780177-780199 TCTCAGGGATGGGGAGGGGATGG - Intergenic
1160923223 19:1530185-1530207 GCTCAGGGAGAGGAGGGGAGAGG - Intronic
1160939753 19:1614742-1614764 TCCCAGGGCCAGGGGGAGGAAGG - Intronic
1160989673 19:1855411-1855433 TCACAGGGAGGGGAGGGGGCGGG + Intronic
1161446865 19:4323511-4323533 CCTGAGGGACAGCGGGGGGAGGG - Exonic
1161768478 19:6219240-6219262 TTTGAGGGGCAGGAGGGGGCTGG - Intronic
1162032802 19:7924765-7924787 TCTCCGGGACAGGCGGTGCAGGG + Exonic
1162123739 19:8487989-8488011 GTTCTGGGACAGGAGGGAGATGG - Intronic
1162279267 19:9681857-9681879 TCTGCAGGACAGCAGGGGGATGG + Intergenic
1162424620 19:10587063-10587085 TCCCAGGGATTGCAGGGGGAGGG + Intronic
1163004505 19:14389140-14389162 TCTCAGGGAGAGGGAGAGGAAGG + Intronic
1163268714 19:16236239-16236261 CCGCAGGGACAGGAGAGGGCTGG + Intronic
1163322851 19:16584725-16584747 GGTGAGTGACAGGAGGGGGATGG + Intronic
1163447056 19:17353036-17353058 TGCCAGGCCCAGGAGGGGGAGGG - Intronic
1163726129 19:18924153-18924175 TCTCAGGGGCGGGTGGGGGCAGG + Intronic
1163782353 19:19257199-19257221 TCTCAGGGAGAGGGGGAGAATGG + Exonic
1163817612 19:19476451-19476473 CCACAGGGACAAGACGGGGAGGG + Intronic
1164479767 19:28602406-28602428 TTTCAGGGACAGGTCAGGGACGG + Intergenic
1164574821 19:29399734-29399756 TCTCTGGGGCAGGTGGAGGATGG - Intergenic
1164782467 19:30904206-30904228 CCTGAGGGACAGGAGGAGGCCGG - Intergenic
1164986854 19:32654550-32654572 TCACACGGACAAGAGGGGGCCGG + Intronic
1165065866 19:33227275-33227297 TCTCTGGGGCTGGAGGTGGAGGG - Intergenic
1165387944 19:35522683-35522705 TCTCAGGGGAAAGAGGGAGAAGG - Intergenic
1166061535 19:40328614-40328636 TCTCAGGGTCAGGATGGAGAAGG + Intronic
1166226905 19:41401635-41401657 GCTCAGGGAAAGGAGGAGGAAGG + Intronic
1166299303 19:41905091-41905113 TCCCAGGGACAGGAGGGCTGTGG + Intronic
1166732783 19:45068161-45068183 CCCCAGGGACAGGGAGGGGAGGG + Intronic
1166851944 19:45765436-45765458 ACGCAGGGACAGGAATGGGAGGG - Exonic
1166864717 19:45828933-45828955 TCTCGGGGACAGGAGGGTGCAGG + Intronic
1166960124 19:46492161-46492183 TCCCAGGGACAAGTGGGGCAGGG + Exonic
1167119042 19:47505859-47505881 TCCCAGGGACAGCAGAGGGTGGG - Intronic
1167208612 19:48119082-48119104 TGTCAGGGGCAGGGGGGAGAGGG + Intronic
1167401050 19:49269696-49269718 TCTGAGGGAGAGGAGGAGGAAGG - Intergenic
1167618736 19:50549855-50549877 TCTCGGGGAGGGGATGGGGAAGG + Intronic
1167641819 19:50686633-50686655 TCTCTGGGGCAGGAAGGTGAGGG + Intronic
1168137770 19:54362920-54362942 TCACAGGGACAGGATGTGGCTGG + Intronic
1168160252 19:54505704-54505726 TCACAGGGACAGGATGTGGCTGG - Intronic
1168701224 19:58440685-58440707 TCTAAGGCACAGGGTGGGGAAGG - Intergenic
925512364 2:4641988-4642010 TCTCTAGGACAGCAGTGGGAGGG - Intergenic
925769158 2:7265516-7265538 GCTCAGTGTCAGGAGGAGGAGGG + Intergenic
926283001 2:11465745-11465767 GCTCCGGGACGGGACGGGGACGG - Intronic
926696187 2:15771417-15771439 CCTCAGGGAGAGGAGGTGAAGGG + Intergenic
927818919 2:26245076-26245098 TCCCAGGGAGGGGAGGGGGCCGG - Intronic
927873567 2:26639817-26639839 TTTCAGGGGAAGGTGGGGGAAGG - Intronic
927966872 2:27275784-27275806 TCTGAGGGACAGAAGTGGGGTGG + Intronic
928199952 2:29241468-29241490 GCTTAGGGCCAGGAGGGAGATGG + Intronic
928441861 2:31298796-31298818 TCTCGGGGGCTGGAGGGAGATGG + Intergenic
929453480 2:42051224-42051246 TGTCAGGGGCGGGATGGGGAGGG - Intronic
929595895 2:43175630-43175652 TCTCAGGGGCAAGAGAAGGATGG + Intergenic
930628281 2:53723480-53723502 ACTCAGGGAAAGGATGGGAAGGG - Intronic
930753549 2:54954343-54954365 TCCCAGGGCCAGGAGGAGGCTGG + Intronic
931214447 2:60228147-60228169 ACTCAGCGTGAGGAGGGGGAGGG - Intergenic
931578664 2:63749093-63749115 CCTCAGGGACAAGAAAGGGATGG + Intronic
932269203 2:70394462-70394484 TGTCAGGGAGGGCAGGGGGAAGG - Intergenic
933267683 2:80199917-80199939 TCTCAGGGAGAGCAGAGGGCAGG + Intronic
934715356 2:96539757-96539779 GCTCAGGGATGGGAGGGGGCTGG - Intronic
936395083 2:112120546-112120568 TCTGAGGGACATGTGGAGGAGGG - Intergenic
936469798 2:112788926-112788948 GCTCAGAGAGAGGAGGGGGAAGG + Intergenic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
937768014 2:125684404-125684426 TCTCAGGCAGAGGATGGGTAAGG - Intergenic
937880197 2:126858885-126858907 TCTCTGGGGCAGGAGGGAGGGGG - Intergenic
938500745 2:131830395-131830417 TCGCAGGGAGAGGATGGGGGAGG - Intergenic
938623328 2:133080844-133080866 TTTCAGAGACAGGAGGGAAAAGG + Intronic
938725411 2:134104376-134104398 AGTCAAGGACAGGATGGGGAGGG + Intergenic
939390561 2:141563865-141563887 ACTCATGGAGAGGAGAGGGAGGG + Intronic
940848025 2:158661954-158661976 ACTCGGGCACAGGAGGGAGAGGG - Intronic
941067477 2:160919496-160919518 TGTCAGGGAATGGAGGAGGAAGG + Intergenic
941702614 2:168620265-168620287 ACTCAGGGAAAGGATGGGAAGGG + Intronic
942205997 2:173620506-173620528 GCTCTAGGACAGGAGTGGGAGGG + Intergenic
942443392 2:176059664-176059686 TGCCAGGGACAGGAGGGTGGAGG + Intergenic
942940079 2:181606332-181606354 GGTTAGGGAGAGGAGGGGGAGGG + Intronic
943960788 2:194260654-194260676 TGCCAGGGACTGGAGGGTGAGGG + Intergenic
944115761 2:196184588-196184610 CCACTGGGACAGGAGGAGGAAGG + Intergenic
944879784 2:204001132-204001154 TCTCAGGGATAGCAGGAGCAAGG + Intergenic
944884334 2:204047512-204047534 GCTCAGGGACTTGAGGGGGCTGG - Intergenic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
946475729 2:220004842-220004864 TCCCTGGAACAGGATGGGGAAGG + Intergenic
947551742 2:231051327-231051349 GCTCTGGGACAGGAGGGAGTGGG + Intergenic
947712747 2:232325494-232325516 TCCCTGGGGCAGGAGGGGGTGGG - Intronic
947795372 2:232890884-232890906 TCTCGGGAACATGACGGGGACGG - Intronic
947987391 2:234460738-234460760 CCTCAGTGACAGGAGGGGTCTGG - Intergenic
948139792 2:235664011-235664033 GCTCAGGGACAGGAGGGATGCGG - Intronic
948309102 2:236971976-236971998 TATCGGGGAGAGGAGGGGGGCGG - Intergenic
948874296 2:240819055-240819077 CCGCAGGGGCGGGAGGGGGAGGG - Intronic
949019906 2:241735155-241735177 ACTCAGGGCCCGGAGGGGAAGGG - Exonic
1169075739 20:2759011-2759033 TCTCAGGGCCAGGTGGGGCGGGG - Intronic
1169685583 20:8267512-8267534 TCTCAGGAACAGGAGAAGGAGGG - Intronic
1169764511 20:9134465-9134487 TTTCAGGGCCAAGAGGGAGAAGG - Intronic
1170736415 20:19017310-19017332 GCTGTGGGACAGGAGGGGCAGGG - Intergenic
1170736472 20:19017595-19017617 CCTCTAGGAGAGGAGGGGGAAGG - Intergenic
1171290252 20:23979093-23979115 GCTCAGGGACAAGTGGGGGCTGG - Intergenic
1171413848 20:24964212-24964234 TCACAGGGACAGGGGTGGGGTGG - Intronic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1172511404 20:35503675-35503697 TCGCTGGGACAGGAGGAGGCTGG - Exonic
1172948434 20:38706168-38706190 TCTCAGGGTGGGGTGGGGGAGGG + Intergenic
1173023876 20:39289869-39289891 GCAAAGGGAAAGGAGGGGGAAGG - Intergenic
1173167525 20:40696105-40696127 ACTCAGGGAGAGGAGGGGGCTGG - Intergenic
1174064328 20:47853654-47853676 TCTCAGACACAGGAGGGGCTGGG + Intergenic
1174177006 20:48651561-48651583 ACCCAGGGACAGCAGTGGGAAGG + Exonic
1174421404 20:50401363-50401385 ACTCAGGGACAGGGATGGGAAGG - Intergenic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1174967874 20:55239803-55239825 TCTGGGGGAAAGGAGGGGAAGGG - Intergenic
1175353646 20:58345010-58345032 TCTGAAGGACAGAAGAGGGATGG - Intronic
1176044513 20:63085415-63085437 GCTCAGGAACAGCAGAGGGAGGG + Intergenic
1176060238 20:63169311-63169333 TCCCAGGCACAGGATGGGGAGGG + Intergenic
1178442039 21:32606138-32606160 TCTCAGGGACAGAACAGAGAGGG + Intronic
1178506197 21:33165180-33165202 TGTGAGGGTCAGGAAGGGGAGGG - Intergenic
1179455020 21:41493304-41493326 ACTCAGAGACAGGAGGTGGCTGG + Intronic
1179481424 21:41681270-41681292 GCTCAGGGCGAGGAGGCGGAAGG - Intergenic
1179801429 21:43813194-43813216 TTCCAGGGACAGGAGAGGGAAGG - Intergenic
1179966925 21:44812731-44812753 GCTCCGGGAGAGCAGGGGGAAGG + Intronic
1180056414 21:45361390-45361412 TCTCTGGGACAAGAGGGGGTTGG - Intergenic
1180123430 21:45769335-45769357 ACTCAGGGACAGGTTTGGGAGGG - Intronic
1180610127 22:17090829-17090851 TCTCTGGGGCAGGAGGGGAGGGG - Intronic
1180767176 22:18351919-18351941 GCTCAGGGACAAGTGGGGGCTGG + Intergenic
1180779134 22:18510460-18510482 GCTCAGGGACAAGTGGGGGCTGG - Intergenic
1180811854 22:18767780-18767802 GCTCAGGGACAAGTGGGGGCTGG - Intergenic
1180998842 22:19978534-19978556 TCCCAGGGGTAGGAGGGGAAGGG + Intronic
1181323429 22:22025939-22025961 GCCCAGGGATAGCAGGGGGAGGG + Intergenic
1181401737 22:22653783-22653805 GCTCAGGGACAAGTGGGGGCTGG + Intergenic
1183642560 22:39101336-39101358 TCCCAGGCACAGGAGGAGCAGGG - Exonic
1184228205 22:43142891-43142913 GCCCCGTGACAGGAGGGGGAAGG - Intronic
1184580465 22:45413331-45413353 GCTCCGGGACTGGAAGGGGAAGG + Intronic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1184834209 22:47011378-47011400 TCTCAGGGTCATGAGGTGGGCGG - Intronic
1184948136 22:47818692-47818714 GCTCTGGGACAGCAAGGGGACGG + Intergenic
1185212035 22:49575807-49575829 TCCCCGTGACAGGAGGGAGAAGG - Intronic
1185233181 22:49694857-49694879 GCTATGGGACAGGAAGGGGAGGG + Intergenic
1185235978 22:49713314-49713336 TCTTAGGGAGAGGAGGGGCGGGG - Intergenic
1185280624 22:49968417-49968439 TCTCAGGTCCAGGATGGGGCTGG - Intergenic
1185397673 22:50601004-50601026 GCTCAGGGACCGCAGGGGGCCGG - Intronic
1203228797 22_KI270731v1_random:92813-92835 GCTCAGGGACAAGTGGGGGCTGG + Intergenic
1203300934 22_KI270736v1_random:76554-76576 TTTCAGGGACTGGAGTGGAAAGG + Intergenic
950105166 3:10384045-10384067 TTTCAGGCACAGGAGGAGGAAGG - Intronic
950604465 3:14065401-14065423 TCTCAGTACCAAGAGGGGGATGG + Exonic
951601434 3:24380474-24380496 TCTGGTGGAGAGGAGGGGGAAGG - Intronic
952882021 3:37991275-37991297 ACCCAGGGACACGAGGGGCAGGG + Intronic
954098712 3:48352939-48352961 TCCCAGGGAAAGGAGGTAGAAGG + Intergenic
954360765 3:50121650-50121672 CCTCAGGGACAGGTGGGGTGTGG + Intergenic
954395029 3:50289006-50289028 TCTCAGTGAAAGGAGGGGTTTGG - Intronic
954626578 3:52025153-52025175 GCTCCGGGGCAGGAGAGGGATGG + Intergenic
954800235 3:53183089-53183111 GCACAGGCCCAGGAGGGGGAAGG - Intronic
956899680 3:73702351-73702373 TCTACGGGACAGCAGGGAGAGGG - Intergenic
957938010 3:86968911-86968933 ACTCAGACACAGCAGGGGGAGGG + Exonic
958465333 3:94450247-94450269 TATCAGGGACGGGAGAAGGAGGG + Intergenic
959013439 3:101106119-101106141 TGCCAGGGTCTGGAGGGGGAAGG + Intergenic
960551582 3:118981894-118981916 CCTCAGGGCCAGCAGGAGGAAGG - Intronic
960705964 3:120481232-120481254 TCTCAGGGACAGAAAGGGGCAGG - Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
964319651 3:155481792-155481814 TTTCAGGGACAGAAGGGCGGAGG + Exonic
965786246 3:172338353-172338375 TATCAGAGGCAGGAAGGGGAAGG + Intronic
966049897 3:175603476-175603498 TGTCAGGGCCTGGAGGGAGAAGG - Intronic
966538996 3:181068108-181068130 TGTCAGGGACATGATGGGGTTGG + Intergenic
966909619 3:184551767-184551789 TCACAGGGACTGAAGGGGGTTGG - Intronic
966911221 3:184561577-184561599 TCTCAGGGGCCGGAGTGGGCGGG - Intronic
966915696 3:184583160-184583182 ACGCAGGAACAGGCGGGGGAGGG + Intronic
967035514 3:185645999-185646021 TGTGAGGGACAGGGGAGGGAGGG + Intronic
967120030 3:186374502-186374524 GCTCAGGGACTGAAGGTGGAAGG - Intergenic
967862216 3:194160698-194160720 TCTCCAGGACAGGCCGGGGATGG - Intergenic
968442159 4:629510-629532 TCCCAGGGAGAGGAGCTGGAAGG - Intronic
968514079 4:1009243-1009265 TCTCAGGAACAGCAGGTGTAGGG - Intergenic
968758385 4:2428323-2428345 CCTGAGGGAAATGAGGGGGACGG - Intronic
969109978 4:4838533-4838555 TCTCGGGTACAGGAGGAGGGAGG - Intergenic
969402748 4:6967818-6967840 ACTCTGGGACAGGAAGGCGAGGG + Intronic
969455297 4:7296854-7296876 TCTCGGGGACAGAAGAGGCATGG + Intronic
969708604 4:8830114-8830136 TCTCGGGGACCAGAGTGGGAGGG - Intergenic
970199066 4:13583521-13583543 TTTCAGGGACTGGAAGGGGATGG + Intronic
971021736 4:22543854-22543876 TCTGAAGGATAGGAGGGTGAGGG + Intergenic
971183503 4:24352166-24352188 TCGGAGGGACAGGAGGGGAATGG + Intergenic
974250397 4:59377126-59377148 GCTCAGGGATAAGAGGTGGAAGG - Intergenic
975374334 4:73626045-73626067 TGCCAGGGACAGGAAGGGCAGGG - Intergenic
975503850 4:75116985-75117007 ACTCATGGAGAGGAGAGGGAAGG + Intergenic
975512540 4:75209641-75209663 TTCCAGGGACAGGAATGGGAAGG + Intergenic
978202426 4:106037852-106037874 TTTCAGGAAGAAGAGGGGGAAGG - Intergenic
978489910 4:109301981-109302003 ACGCAGGGAAAGGAGGGGGCCGG - Exonic
978833181 4:113114222-113114244 TCTCAAGGGCAGGAGGGCCAAGG - Intronic
979168245 4:117564416-117564438 TTTTGGGGACTGGAGGGGGAAGG - Intergenic
979189011 4:117834248-117834270 ACTCAGGGATAAGAGGTGGAAGG - Intergenic
982382472 4:154763691-154763713 TGTCAGGGAAAGGAGGAGGAAGG + Intergenic
983347634 4:166546750-166546772 TTACAGGCACAGGATGGGGAGGG + Intergenic
984700084 4:182813697-182813719 TCTCAGGCAAGGGAGGTGGATGG - Intergenic
984739496 4:183146570-183146592 TTTCTGGGACAGGGTGGGGAAGG + Intronic
985507405 5:291492-291514 TCTCAGGGAGAGAATGGAGATGG - Intronic
985507415 5:291559-291581 TCTCAGGGAGAGAATGGAGACGG - Intronic
985507426 5:291626-291648 TCTCAGGGAGAGAATGGAGACGG - Intronic
985507436 5:291693-291715 TCTCAGGGAGAGAATGGAGACGG - Intronic
985740537 5:1613440-1613462 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740547 5:1613507-1613529 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740557 5:1613574-1613596 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740567 5:1613641-1613663 TCTCAGGGAGAGAATGGAGACGG + Intergenic
985740576 5:1613708-1613730 TCTCAGGGAGAGAATGGAGACGG + Intergenic
987395096 5:17415657-17415679 CCTCAGTAACAGGAGGGGGAAGG + Intergenic
987554612 5:19431042-19431064 CTTCAGGGACTGAAGGGGGATGG - Intergenic
988029559 5:25745475-25745497 TCTCTGGAAGAGGTGGGGGATGG + Intergenic
988435392 5:31168369-31168391 TTGCAGGGACAGGGGTGGGAGGG - Intergenic
988829076 5:34970092-34970114 TCTCAGGAACAGGAGTAGAAGGG + Intergenic
990475953 5:56162069-56162091 TCTGAGGGACTGGGGGAGGAGGG + Intronic
991669686 5:69035579-69035601 GCTGTGGGACAGGAGGGTGAAGG + Intergenic
992998644 5:82357559-82357581 ACTCAGGGAGAGGAGAGGAAAGG + Intronic
993533574 5:89052815-89052837 AGTTAGGGAAAGGAGGGGGATGG + Intergenic
994355673 5:98791791-98791813 TCTCTGGTACAGGTGGTGGAGGG - Intronic
994936417 5:106259004-106259026 GCTAAGGGACTGGAGGGGGAAGG - Intergenic
995830074 5:116345240-116345262 TCTCAGGGGTAGGAGGGAGGGGG + Intronic
997192798 5:131954740-131954762 TCTCAGGCATAGGAGGGGAGAGG + Intronic
997475551 5:134140387-134140409 TCTCAGGGATTTGAGGAGGAAGG + Intronic
998147548 5:139738849-139738871 GCTCAGGGACAGGTTGGGGTAGG - Intergenic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
999257968 5:150220342-150220364 AATCAGGGGCAGGTGGGGGAGGG + Intronic
999419993 5:151432477-151432499 TCACAGGGTCAGGAGAGGGTAGG + Intergenic
999590342 5:153138049-153138071 TCTCAGAGAAATGAGGGGCAGGG + Intergenic
1000367350 5:160504234-160504256 GATCAGGGACAGGAGCAGGAAGG - Intergenic
1000621317 5:163489615-163489637 TCTCTGGCTCATGAGGGGGATGG - Intronic
1001254307 5:170171884-170171906 GCTCAGGGACAGGCAGGGGAGGG - Intergenic
1001661478 5:173396659-173396681 CCTCAGGGACTGGATGGGGATGG + Intergenic
1002160092 5:177309939-177309961 CTCCAGGGACAGGAGGGGAAAGG - Intronic
1002399721 5:178984863-178984885 TCTCAGGGCCAGGTGGAGGGTGG - Intronic
1002422904 5:179158871-179158893 GCTCATGGACTGCAGGGGGATGG + Exonic
1003631367 6:7790657-7790679 TATCAGGGACAGCAGGTTGATGG + Intronic
1003774969 6:9350040-9350062 TTTCAGGAACAGAAGTGGGATGG + Intergenic
1004015645 6:11729483-11729505 TCTCAGGGACAGGAGGGGGAAGG - Intronic
1004020249 6:11770502-11770524 TCTAAGGGACAGGAAGGGAAAGG + Intronic
1004032163 6:11881266-11881288 TGTGAAGGAGAGGAGGGGGATGG + Intergenic
1005587879 6:27294730-27294752 ACTCAGGGAAAGAAGGGGAAGGG - Intronic
1006001935 6:30972135-30972157 TCACAGGGACAGGAGAGGGTGGG - Intergenic
1006009565 6:31031235-31031257 TCACAGGGATAGGAGAGGGTGGG - Intronic
1006576564 6:35050797-35050819 GCTCAGGGCCAGGAGGGACATGG - Intronic
1006641721 6:35492695-35492717 TCTCAGGGAGCAGAGGGGGTTGG + Intronic
1007019278 6:38503309-38503331 TCTCCTGGAGAGAAGGGGGAGGG - Intronic
1007270807 6:40635534-40635556 TTTCAGAGAGTGGAGGGGGAGGG - Intergenic
1007393294 6:41562824-41562846 CCTCAGTTACATGAGGGGGATGG - Intronic
1008555995 6:52673292-52673314 TCTATGGGACAGGTGGGGCAGGG - Intronic
1011993865 6:93559864-93559886 TGCCATGGACAGGAGGGGGATGG + Intergenic
1013075243 6:106765286-106765308 TTTCAGAGACAGAAGGGTGAGGG + Intergenic
1014512625 6:122343056-122343078 TCTCAGAGATTGGAGGGAGAGGG + Intergenic
1016092435 6:139996384-139996406 TTTCAGGGACTTGAGTGGGAGGG - Intergenic
1016735629 6:147476723-147476745 CCTCAGAGACAGTAGGAGGAAGG - Intergenic
1016975498 6:149803524-149803546 TCTCATGGAAGGGAGTGGGAAGG - Intronic
1016997302 6:149969735-149969757 TCCCAGGGCCAGGGAGGGGAGGG - Intronic
1017311370 6:152982085-152982107 TCTCAGGGCCTGGAGTGGAAAGG - Intronic
1017908276 6:158771635-158771657 TCTCTGGGACGGGTGGAGGAAGG + Intronic
1018423742 6:163662350-163662372 CATCAGGAACAGGAGGCGGAAGG - Intergenic
1019924400 7:4182613-4182635 CCTGAGGGAGAGGAGGGAGAAGG + Intronic
1020117896 7:5486720-5486742 TGTCAGAGACAGGAGGGTGATGG + Intronic
1020210725 7:6156241-6156263 TCTCAGGCACATGGGAGGGAAGG + Intronic
1020947100 7:14625366-14625388 TATGAGGGACAGGAAGGGGGAGG + Intronic
1021688842 7:23213054-23213076 TATGAGGAAGAGGAGGGGGAGGG + Intergenic
1021776377 7:24059035-24059057 TCTCAGCGAAAGGAGAGAGAAGG + Intergenic
1022170466 7:27823778-27823800 TTTCAGGGACTGGAGGAAGAGGG - Intronic
1022473271 7:30694584-30694606 TGCCAGGGACCGGAGGGGAATGG + Intronic
1023492610 7:40760423-40760445 TGTCAGGGGCTGGAGGGAGAGGG + Intronic
1023625235 7:42108930-42108952 TCTCAGAGACAGGGGTGGGAGGG - Intronic
1023910026 7:44547250-44547272 ACACAAGGACAGGATGGGGAGGG + Intergenic
1024005149 7:45219848-45219870 CCTCAGGCACAGGAGGCAGATGG - Intergenic
1025249422 7:57342101-57342123 ACTCAGGGACAGGGATGGGAAGG + Intergenic
1026025479 7:66740831-66740853 TCTCAGCTACAGGAGCGGGGCGG + Intronic
1026877171 7:73886480-73886502 GCTCTGGGACAGGAGGGAGGCGG + Intergenic
1027297815 7:76796211-76796233 TATCAGGGTCGTGAGGGGGAGGG - Intergenic
1029327383 7:99822023-99822045 TCTCAGGGAAGGGTGAGGGAAGG + Intergenic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1029594132 7:101527895-101527917 TCACAGAGCCAGGAGGGGGCAGG + Intronic
1029627104 7:101726797-101726819 TTTCAGGGGCGGGAGGAGGAAGG - Intergenic
1031837627 7:126697218-126697240 TATCAGGGACAAGGAGGGGATGG + Intronic
1032387196 7:131533202-131533224 TCCCAGGGAAGGGACGGGGAGGG - Intronic
1032521187 7:132546553-132546575 ACTCAGGAACAGAAGGGGGCAGG + Intronic
1032684902 7:134223417-134223439 TCTCAGAGGCAGCAGGGGGTAGG + Intronic
1033584258 7:142762542-142762564 TCACATGGGCAGGAGAGGGATGG - Intronic
1034349509 7:150407038-150407060 TCTCAAGGACAGGGGGAGGTAGG - Intronic
1035381896 7:158445791-158445813 TCACGGGGACAGGAGGAGGTGGG - Intronic
1036691192 8:10945882-10945904 GCTTGGGGACAGGAGAGGGAAGG - Intronic
1036760452 8:11505379-11505401 GCTCAGGGACAAGGGGTGGAGGG - Intronic
1036979913 8:13459287-13459309 TCTCTGGGACAGGAAGTGGAGGG + Intronic
1037701126 8:21274691-21274713 ACACAGGGAGTGGAGGGGGAAGG - Intergenic
1037813014 8:22097851-22097873 GATCGGGAACAGGAGGGGGAGGG + Intronic
1037897501 8:22667805-22667827 TCTAAGAAACAGGTGGGGGAGGG + Intronic
1037906777 8:22720076-22720098 GCACAGGGACAGGTGGGAGAAGG + Intronic
1038726659 8:30088112-30088134 TCTCCGGGAGAGGAGGGAGCCGG - Intergenic
1039549994 8:38436445-38436467 TCTCATCAACAGGAGTGGGAAGG + Intronic
1039721479 8:40169065-40169087 TCTCAGGAACCAGACGGGGAAGG + Intergenic
1039904869 8:41779181-41779203 TCTCAGGGATAGGAGAGGGATGG - Intronic
1040896366 8:52373158-52373180 TTTCTGGGAAAGGAGGGGAAGGG + Intronic
1041545228 8:59034941-59034963 TCTCAAGGTCAGGAAGTGGAAGG + Intronic
1043459126 8:80441670-80441692 TTTCAGGTACAGGAGTGGGATGG + Intergenic
1043701691 8:83296585-83296607 TGCCAGGGACTGGAGGGAGAAGG - Intergenic
1044661987 8:94600574-94600596 TCTGAGGGAGAGGCTGGGGAGGG + Intergenic
1044927758 8:97223888-97223910 CATCAGGGACAGAAGGGGAAGGG + Intergenic
1047248733 8:123166100-123166122 TATCAGGGCCGGGAGGGGGCTGG + Intergenic
1047476468 8:125236598-125236620 TCTGAGAGACAGGAAGGGCATGG + Intronic
1047941210 8:129829211-129829233 TCTCAGGGGAAGGAGGGAGCAGG - Intergenic
1048949521 8:139483822-139483844 GCTCAGGGACAGAAGGGAAATGG - Intergenic
1049023606 8:139973876-139973898 TCGCAGGGACTCGAGAGGGATGG - Intronic
1050085912 9:1965517-1965539 TCTTAGGGCCAAGAGGGGAAGGG + Intergenic
1050988249 9:12110388-12110410 TCTCAGGGAAAAGATTGGGAAGG + Intergenic
1052207669 9:25862900-25862922 ACTAGGGGACAGGAAGGGGAAGG + Intergenic
1053204067 9:36171688-36171710 TCTCATGGCCAGGAAGGAGAAGG + Intergenic
1054906581 9:70418859-70418881 ACCCAGGGGCTGGAGGGGGAAGG + Intergenic
1055091101 9:72365233-72365255 TGTGAGGGAAAAGAGGGGGAGGG + Intronic
1056431785 9:86535198-86535220 TTTAAGGGAAAGGAAGGGGAAGG - Intergenic
1056605178 9:88079369-88079391 TGTCAGGGAGAGGAGAGGGTTGG + Intergenic
1057168990 9:92949602-92949624 CCTCAGGGACAGGATGGGTTTGG + Intronic
1057468412 9:95337161-95337183 TCTCAGGGACTGGAGCAGGCAGG + Intergenic
1057713301 9:97466776-97466798 TGCCTGGGACAGGAGGTGGAGGG + Intronic
1058508145 9:105687570-105687592 TCACAGGGAGAGGAGTAGGAAGG - Intergenic
1058756373 9:108086491-108086513 CCTCAGGGAGAGGATGAGGAGGG + Intergenic
1058778770 9:108312129-108312151 TCTAAAGGACAAGAGGGGAAAGG + Intergenic
1059438838 9:114291394-114291416 TCTGAGACACAGGAGGCGGAGGG + Intronic
1059677179 9:116550704-116550726 TCTCAGGGATATTAGGAGGAGGG - Intronic
1060220966 9:121763914-121763936 ACTGAAGGACAGGATGGGGAAGG - Intronic
1060495542 9:124115771-124115793 TATCAGGGGCTGGAGGGAGAGGG + Intergenic
1060552829 9:124493682-124493704 TCTCAGGCTCAGGAGGAGGAGGG + Intronic
1060940633 9:127541134-127541156 TCTCAGGCACATGATGGAGATGG - Intronic
1061190813 9:129081541-129081563 TCTCTGGGACAGGGGAGGGCGGG - Intronic
1061293971 9:129667053-129667075 TTTCAGAGACAGGAGGTGCAGGG + Intronic
1061330542 9:129889717-129889739 TCTCAGGGACAGGAAAGTGATGG + Exonic
1061433847 9:130548174-130548196 TCCCAGGGACGGCAGGGGCAGGG - Intergenic
1061660823 9:132129158-132129180 TGTCAGGGGCTGGAGGGAGAGGG - Intergenic
1061783533 9:133009458-133009480 TCTGGGGGAAAGGAGTGGGAGGG + Intergenic
1062303629 9:135889713-135889735 GCTCAGGGGAAGGAGGAGGAGGG - Intronic
1062313358 9:135952086-135952108 ACTCAGGGACAGGCGGAGGCAGG + Intronic
1062334818 9:136060500-136060522 CCTCAGGGAGGGGAGAGGGATGG - Intronic
1062464001 9:136673287-136673309 TCTCTGGGAGAGGAGGGGCCTGG - Exonic
1062590338 9:137271802-137271824 GCCCAGGGACAGGAGGAGGGTGG - Intronic
1062590352 9:137271837-137271859 GCCCAGGGACAGGAGGGTGGAGG - Intronic
1186107905 X:6226667-6226689 GTTGAGGGACAGGAGGAGGAAGG + Intronic
1186195787 X:7109239-7109261 TCTCAGGGCAAGGAGATGGACGG + Intronic
1187181507 X:16947141-16947163 CCGCAGGGACAGGAGGCGGAGGG - Intronic
1187263983 X:17714020-17714042 TGTCAGGGACAAGATGGGCATGG + Intronic
1188107183 X:26159643-26159665 TCTTAGGGGCAGGATGGGGCAGG - Intergenic
1190020895 X:46873888-46873910 GCTCAGGGTCAGGTGGGGGTGGG - Intronic
1190424108 X:50315773-50315795 TGTCAGGGACAGGAAGGAGAGGG - Intronic
1190497895 X:51044265-51044287 TCTTAGGTGCAGGAGTGGGAGGG + Intergenic
1191026791 X:55922458-55922480 TCAGGGGGACAGCAGGGGGAGGG + Intergenic
1191217729 X:57951160-57951182 TATCAGTGGCAGGAGTGGGAAGG + Intergenic
1191670682 X:63745624-63745646 ACTAAGGCACAGGAGGGGAAAGG - Intronic
1191922290 X:66270048-66270070 TCTCATGGAGAGGAAGGGAAGGG + Intergenic
1192465140 X:71349613-71349635 TCTTAGGGACAGGCCGGGCACGG - Intergenic
1192473149 X:71416876-71416898 TCTTAGGGACAGGCCGGGCACGG + Intronic
1194945746 X:100064855-100064877 TCTCCGGGAGAGGAGCGGGTAGG + Intergenic
1195962704 X:110402431-110402453 TGTCAGGGAGAGGAGACGGAAGG + Intronic
1196531209 X:116788829-116788851 TTTCAGGGACATGGGGGGAAAGG + Intergenic
1197301453 X:124786798-124786820 TATCATGGATAGGAAGGGGAAGG - Intronic
1197402033 X:126004959-126004981 TCTCATGGAGAGGAAAGGGAGGG + Intergenic
1197560856 X:128019373-128019395 TCTGAGGGACAAAAGGGGAAAGG + Intergenic
1198575851 X:138009569-138009591 ACACAGGGAGAGCAGGGGGAAGG - Intergenic
1198985714 X:142450609-142450631 GCTGAGGGCCAGGAAGGGGAGGG - Intergenic
1199636179 X:149813933-149813955 TCTCTTGGAGAGGAGGGTGACGG - Intergenic
1199665825 X:150095662-150095684 TGTCAGAGTCAGGAGGAGGATGG - Intergenic
1199893385 X:152110042-152110064 CCTGAGGGAAAGAAGGGGGAAGG - Intergenic
1199950984 X:152706145-152706167 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199953281 X:152722759-152722781 CCTGAGGGAGAGAAGGGGGAAGG + Intergenic
1199956401 X:152745691-152745713 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1199958698 X:152762316-152762338 CCTGAGGGAGAGAAGGGGGAAGG - Intergenic
1201716126 Y:17045753-17045775 TGTCATGCACAGGAGAGGGATGG + Intergenic