ID: 1004021752

View in Genome Browser
Species Human (GRCh38)
Location 6:11782288-11782310
Sequence CACATCATAATTTGTGTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 159}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1004021750_1004021752 7 Left 1004021750 6:11782258-11782280 CCAATGAAAAATCTACATTGCAA 0: 1
1: 0
2: 3
3: 26
4: 286
Right 1004021752 6:11782288-11782310 CACATCATAATTTGTGTTCCTGG 0: 1
1: 0
2: 2
3: 16
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1004021752 Original CRISPR CACATCATAATTTGTGTTCC TGG Intronic
903944207 1:26951573-26951595 CACATCAGACACTGTGTTCCTGG - Exonic
905204427 1:36335059-36335081 CACATCAAAAATTGCCTTCCTGG + Intergenic
908009223 1:59758761-59758783 CATCTCATACTTTGTGTTTCTGG - Intronic
908662686 1:66454128-66454150 CAAGTCATAATTTGCTTTCCAGG + Intergenic
909797839 1:79765494-79765516 CACCTCTTCATTTGAGTTCCAGG + Intergenic
910227291 1:84948684-84948706 CAAATCATAAATTATGTTCCTGG - Intronic
912230918 1:107791305-107791327 CACATTCTAATTTGTTTTCTAGG + Intronic
914328185 1:146641439-146641461 CACATCATGTTTTGTTTTCCAGG + Intergenic
915182571 1:154075435-154075457 CAAATATTTATTTGTGTTCCTGG - Intronic
915542605 1:156577938-156577960 CACTTCATAATTTTTGTTTCTGG + Intergenic
916187530 1:162147514-162147536 CACATTATGATTCGTGTACCAGG + Intronic
916440268 1:164818034-164818056 CAAATTATAATTTGGGTTCTTGG + Intronic
918636165 1:186776957-186776979 CACATCATATTTCTTTTTCCAGG - Intergenic
918978257 1:191519280-191519302 CACTTCTTAATTTGTGGTCTGGG + Intergenic
919326582 1:196115022-196115044 TCCATCATGATTTCTGTTCCTGG - Intergenic
922294602 1:224238607-224238629 AAGATCATAGTTTGTGTCCCAGG - Intronic
1065848557 10:29766835-29766857 CACATGTTAATTTGTGTTAGTGG + Intergenic
1067729870 10:48802924-48802946 AACATCATCATTTGTCTTGCAGG + Intronic
1068330314 10:55556763-55556785 CACTTCATAATTTGCCTCCCGGG - Intronic
1070060614 10:72980058-72980080 CAAATCATGAGTTGTTTTCCTGG + Intergenic
1070486368 10:76935651-76935673 CTCCTCAAAATTTGTGTGCCTGG - Intronic
1071302528 10:84266891-84266913 CACATCAGAATCTCTGTGCCAGG - Intergenic
1071923910 10:90383477-90383499 CTAATCATAATTTGTGATCCAGG - Intergenic
1072557698 10:96535617-96535639 CCCATATTAATTTGAGTTCCAGG - Intronic
1073594757 10:104788785-104788807 CACATAATAATGAGAGTTCCTGG - Intronic
1077405779 11:2381960-2381982 CACACCATTCTTTGTGTTTCTGG + Intronic
1080079860 11:28203865-28203887 CAGATCATTATTTGTGTTCTAGG + Intronic
1080474864 11:32580894-32580916 CACATCATGGTTTGGGTGCCAGG + Intergenic
1080485503 11:32703047-32703069 CATATATTATTTTGTGTTCCTGG + Intronic
1081274567 11:41132877-41132899 TACATCTTCATTTGTATTCCTGG - Intronic
1081565355 11:44257532-44257554 CACATCCTGATTGGGGTTCCGGG + Intergenic
1090985658 11:131763555-131763577 CACAACTTACTTTGTGTTTCGGG + Intronic
1094193511 12:27721355-27721377 CACTTCCAAATTTGTGTCCCAGG + Intronic
1098569599 12:71973816-71973838 TACATTATAATTTGTGTGTCAGG + Intronic
1099060052 12:77896808-77896830 CACATCAAAATTGGGTTTCCTGG - Intronic
1100288629 12:93192130-93192152 CAGATCCTAATTCTTGTTCCTGG - Intergenic
1100674944 12:96856251-96856273 AACATCACAATTTATGCTCCAGG - Intronic
1102350599 12:112189218-112189240 CACATCAACATTTGGATTCCTGG + Intronic
1103140436 12:118543392-118543414 CACATTATGATTTGTTTTTCAGG - Intergenic
1105746811 13:23384874-23384896 CACATAATATTTTGTTTTCCCGG + Intronic
1110477554 13:75934737-75934759 CACATCAGCATTTGTATTCCTGG - Intergenic
1116065499 14:39977092-39977114 GTCATCATAATTTATTTTCCTGG + Intergenic
1117538552 14:56724788-56724810 CACATCAGAGTTTGTGTGCAAGG - Intronic
1117902460 14:60549972-60549994 CAAATCATGAATTGTTTTCCTGG + Intergenic
1118513495 14:66502542-66502564 GAAATCAAAATTTTTGTTCCTGG + Intergenic
1119078624 14:71670908-71670930 CACAACATAATTTTTTTTCTAGG - Intronic
1121991962 14:98566990-98567012 CACATCATTCATTGTGGTCCAGG - Intergenic
1122173358 14:99896215-99896237 CATCTTATAATTTGTGTTCCAGG - Intronic
1124924288 15:34056057-34056079 CTCAGCATATTTTGAGTTCCTGG - Intronic
1126616286 15:50584217-50584239 CAGAACAAAATTTGTATTCCAGG + Intronic
1126773605 15:52080947-52080969 CAGAACATAATCTGGGTTCCTGG - Intergenic
1127292082 15:57579955-57579977 CACCTCAGAGTCTGTGTTCCAGG + Intergenic
1127685866 15:61343111-61343133 GACAGCATAATTTCTTTTCCTGG + Intergenic
1131864532 15:96693373-96693395 CACATCATAATCTGCGGTCCGGG - Intergenic
1131997511 15:98146274-98146296 CACATCTTAATTTCAGTCCCCGG + Intergenic
1132786641 16:1660561-1660583 GGGATCATAAATTGTGTTCCTGG + Intronic
1134611927 16:15615907-15615929 CACTTCATTACCTGTGTTCCAGG - Exonic
1137646756 16:50081637-50081659 CTGAATATAATTTGTGTTCCTGG - Intronic
1138622963 16:58226370-58226392 GACATCATTAATTGTGTCCCTGG + Intergenic
1140005377 16:71069502-71069524 CACATCATATTTTGTTTTCCAGG - Exonic
1140421361 16:74821944-74821966 AACCTCATCATTTGTGTTCAGGG - Intergenic
1140974124 16:80043066-80043088 CATATCAGAATTGGTCTTCCTGG - Intergenic
1145164752 17:20604585-20604607 TACATCAATATTTCTGTTCCTGG + Intergenic
1146028233 17:29341726-29341748 CACATCCTGGTTTGTATTCCAGG - Intergenic
1148749792 17:49938909-49938931 CACAGCAAAATGTGTGTTCTGGG - Intergenic
1156420997 18:36952905-36952927 CACATGATAATTTGTGGTAGAGG + Intronic
1156780867 18:40849025-40849047 CAAATCAGAATTCCTGTTCCAGG + Intergenic
1157993788 18:52529843-52529865 CACATCATAAGAACTGTTCCTGG - Intronic
1158754678 18:60307850-60307872 TATATCAAAATTTGTGTTTCAGG + Intergenic
1162806376 19:13139883-13139905 CACATCCTTGTTTGTGTTTCTGG + Exonic
1163970361 19:20787821-20787843 CAAATCAGAATGGGTGTTCCAGG + Intronic
927641851 2:24850378-24850400 CACCCCTTCATTTGTGTTCCTGG + Intronic
930309534 2:49721670-49721692 CAGATAATAATTTCTGTTACAGG - Intergenic
941861509 2:170286148-170286170 CACATCATGAAGTGTGGTCCAGG + Intronic
942484465 2:176424541-176424563 CACATCAGGATTTGAATTCCAGG + Intergenic
942713467 2:178864502-178864524 CAGCTCATAATTTGTGTTCCAGG - Intronic
943280522 2:185926562-185926584 ATCATCATAATTTTTGCTCCTGG - Intergenic
943568495 2:189544524-189544546 CAGCTCATCATTGGTGTTCCTGG - Intergenic
944105836 2:196078343-196078365 AACATCATTATTTGTTTTCATGG - Intergenic
944402402 2:199343177-199343199 CACCTTATATTTTGTGTTCCTGG - Intronic
944402407 2:199343250-199343272 CACCTTATATTTTGTGTTCCTGG - Intronic
947905952 2:233762581-233762603 AACATTACAATTTGTATTCCAGG + Intronic
948960866 2:241335731-241335753 AAAATTATAATTTCTGTTCCTGG - Intronic
1169409268 20:5353350-5353372 CACATCATACTTTATTTTCTGGG - Intergenic
1171437965 20:25138316-25138338 CACATCACAATTGCTTTTCCTGG + Intergenic
1172155473 20:32820693-32820715 CTCATCATAATGTGGATTCCTGG - Intronic
1174688227 20:52476217-52476239 CACATTAGAATTTCTGTTCCTGG + Intergenic
1177753284 21:25313538-25313560 CCAATCATAATTTGTGTTTATGG + Intergenic
1178206096 21:30468369-30468391 CACATCATATTGAGTCTTCCAGG - Intergenic
1178454483 21:32735447-32735469 CAAATAACGATTTGTGTTCCAGG - Intronic
1178810226 21:35874964-35874986 CACATCACAAGCAGTGTTCCTGG - Intronic
951856331 3:27201241-27201263 CATATCATAATGTGTTTTACAGG + Intronic
951943664 3:28110447-28110469 CACATCTGAATTTTTGTTACTGG + Intergenic
953552328 3:43913165-43913187 CAAAACAGCATTTGTGTTCCAGG + Intergenic
954849760 3:53590303-53590325 CACATCATCATTTGTTTCCTAGG + Intronic
959654833 3:108791479-108791501 CACAGCAAAATTTGCTTTCCTGG + Intergenic
960545357 3:118908008-118908030 AACCACATAATTTGTGTTCCTGG + Intronic
960551429 3:118980415-118980437 CACATAATACTTTTTGTGCCTGG - Intronic
960876143 3:122296941-122296963 CAGATCAAAATTTTTGTTTCTGG - Intergenic
960927253 3:122807154-122807176 CACATGATTATTATTGTTCCTGG - Intronic
962979595 3:140475759-140475781 AAAATCATTATTTGTGTTTCAGG + Intronic
964458020 3:156890444-156890466 CACATAATAATTTGTTGTCTTGG - Intronic
966608181 3:181842815-181842837 CATTTCATAATATGTGTTCGAGG - Intergenic
967770724 3:193330874-193330896 AACTTAATAATTTGTGTGCCTGG - Intronic
973106000 4:46338319-46338341 CAAATTATAATTAGTTTTCCTGG - Intronic
974670916 4:65028764-65028786 GACATCATAATGTTTGGTCCTGG - Intergenic
975038674 4:69716148-69716170 CATTTTATAATTTTTGTTCCTGG - Intergenic
978289883 4:107125165-107125187 CACATTATAATTTGTCTTGGAGG - Intronic
978347137 4:107783204-107783226 CACATTATAATTCTTGTTCTTGG - Intergenic
978707706 4:111734957-111734979 CAAATCATAAATAGTGTTACAGG - Intergenic
978738741 4:112113900-112113922 CACATCCTAATGTGTCTTCATGG + Intergenic
980016783 4:127659032-127659054 CACAACAGGTTTTGTGTTCCTGG + Intronic
983372349 4:166877184-166877206 CACAAAATAATTTGTGTACATGG - Intronic
987059472 5:14228229-14228251 CACATCAGAATTGGAGCTCCAGG - Intronic
988509357 5:31852927-31852949 CACATCATCAATTATGTACCTGG + Intronic
988630183 5:32921135-32921157 CACATCAAAATGTTTTTTCCAGG - Intergenic
989524318 5:42435712-42435734 CACATCTTCTTTTCTGTTCCAGG + Intronic
990146716 5:52769236-52769258 CACATCACTATTTGTGATCTAGG + Intergenic
992952075 5:81869108-81869130 TCCATCAACATTTGTGTTCCTGG - Intergenic
993921880 5:93815231-93815253 CACTTCATATTTTCTGTTACAGG - Intronic
997443294 5:133923976-133923998 CAAATAATAATTTGTGATTCAGG - Intergenic
1000309106 5:160024430-160024452 AACATCATCTTTTCTGTTCCAGG + Intronic
1000631250 5:163593324-163593346 AAGATCATAATTTGAGTCCCTGG - Intergenic
1001079223 5:168654690-168654712 CACATCATAAAGTGTGGGCCAGG + Intergenic
1004021752 6:11782288-11782310 CACATCATAATTTGTGTTCCTGG + Intronic
1010410748 6:75558843-75558865 CAGATCTTTATTTGTCTTCCAGG - Intergenic
1012277167 6:97288449-97288471 TAAATCATAATATGTGTGCCAGG - Intergenic
1012388635 6:98710708-98710730 GCCATCATTATTTGTATTCCTGG + Intergenic
1021149912 7:17137154-17137176 GACATCATAATTTTAGTTCAGGG + Intergenic
1022850291 7:34254968-34254990 CACATCTTCAGTTGTCTTCCAGG + Intergenic
1026433791 7:70375360-70375382 CACATTAAAATGTGTGTACCTGG + Intronic
1029260203 7:99296990-99297012 CACATCATCAGTTGAGTACCTGG + Intergenic
1030638378 7:111975637-111975659 CACCTCATAAATTTTGTCCCTGG + Intronic
1031485604 7:122319687-122319709 CAAATTATAATTTATGTGCCAGG - Intronic
1033025062 7:137764254-137764276 CACACCAGAATTATTGTTCCAGG + Intronic
1039085476 8:33775528-33775550 CACATAAAAATTTGTATTTCTGG - Intergenic
1040718474 8:50287915-50287937 CTCATCATATTGTGTTTTCCAGG + Intronic
1043190485 8:77215403-77215425 CAAATCAGAATTTATTTTCCAGG + Intergenic
1043287370 8:78550546-78550568 CAGATCTGAATCTGTGTTCCAGG - Intronic
1043987974 8:86716241-86716263 CAAAGAATAATTGGTGTTCCTGG + Intronic
1044002110 8:86895599-86895621 CTCATCATCATTTGTGTTGTTGG + Intronic
1044053069 8:87533953-87533975 AACATCATAAATTGTGATACTGG + Intronic
1045188889 8:99864247-99864269 CACATAATAATTTGAAATCCAGG + Intronic
1045654723 8:104375173-104375195 CAAATCATTATTTGTGTCCAGGG - Intronic
1047294011 8:123555169-123555191 CACATTACAATTTAGGTTCCAGG + Intergenic
1048703210 8:137118481-137118503 CACATAAAAATTTGTCCTCCAGG - Intergenic
1051038103 9:12774135-12774157 CATATAAGTATTTGTGTTCCTGG - Intergenic
1051326606 9:15978383-15978405 TACATCATAATGTGTGTGACTGG + Intronic
1052643280 9:31197594-31197616 CAAATCATCATTTGTTTCCCAGG - Intergenic
1053149049 9:35731587-35731609 TACGTCATAATTTGAGTTCAGGG - Intronic
1053601480 9:39614587-39614609 CATAACATAGTTTGTGTTCTTGG + Intergenic
1053859130 9:42368368-42368390 CATAACATAGTTTGTGTTCTTGG + Intergenic
1054252053 9:62727851-62727873 CATAACATAGTTTGTGTTCTTGG - Intergenic
1054566167 9:66762352-66762374 CATAACATAGTTTGTGTTCTTGG - Intergenic
1055637640 9:78294561-78294583 CACATAAAAATCTGGGTTCCTGG + Intergenic
1188083573 X:25875734-25875756 CAAATCATAAATTGTTTTCCTGG - Intergenic
1188701096 X:33264870-33264892 GTCATCATAATTTCTGTGCCAGG - Intronic
1189055468 X:37694992-37695014 CACATCAGCTTTTGTGATCCAGG + Intronic
1189078693 X:37945344-37945366 CTCATCTTACTTTGTATTCCTGG + Intronic
1190419479 X:50214852-50214874 CACATCAAAATTTGTGGGCCAGG - Intronic
1192199765 X:69059440-69059462 CACATCTTATTTTCCGTTCCAGG - Intergenic
1193239822 X:79154931-79154953 CACTTCATTATTTTTTTTCCAGG - Intergenic
1195216381 X:102707909-102707931 CAAATTATAATTTTTATTCCTGG - Intergenic
1199008442 X:142730254-142730276 CATGTCATAATTTGTTTTGCAGG + Intergenic
1199897473 X:152138136-152138158 GACGTCAGAATTTGCGTTCCTGG + Intronic
1200830013 Y:7680277-7680299 TTCATCATCATTTGTGATCCCGG - Intergenic
1200988492 Y:9327151-9327173 TTCATCATCATTTGTGATCCCGG - Intergenic
1201060176 Y:10037615-10037637 GACTTCATCATTTGTGCTCCTGG - Intergenic
1201181479 Y:11351740-11351762 CACATAAAAAATTTTGTTCCAGG + Intergenic
1201462069 Y:14237333-14237355 CAGATCACACTTTGTGTTCCTGG + Intergenic
1201719324 Y:17079421-17079443 CACTTCCTATTTTTTGTTCCAGG - Intergenic
1202119508 Y:21509041-21509063 TTCATCATCATTTGTGATCCCGG + Intergenic
1202121960 Y:21532581-21532603 TTCATCATCATTTGTGATCCCGG + Intronic
1202157046 Y:21896801-21896823 TTCATCATCATTTGTGATCCCGG - Intronic
1202159492 Y:21920342-21920364 TTCATCATCATTTGTGATCCCGG - Intergenic
1202185938 Y:22185257-22185279 TTCATCATCATTTGTGATCCCGG - Intergenic
1202196891 Y:22306495-22306517 GACTTCATCATTTGTGATCCCGG + Intergenic
1202205421 Y:22401139-22401161 TTCATCATCATTTGTGATCCCGG + Intronic